Claims

CLAIM
1. The ornamental design for a foldable shoe box as shown and described....

Claims

What is claimed is:
1. A load-aware directory migration method in a distributed file system (DFS), the method comprising:
1) receiving a plurality of directory requests created by DFS clients, parsing each of the plurality of directory requests, to obtain directory request information corresponding to the plurality of directory requests;
2) inputting all of the directory request information corresponding to the plurality of directory requests obtained in 1) into a pre-trained machine learning model, to obtain directory labels corresponding to all directory requests;
3) obtaining a label corresponding to a maximum score interval from the directory labels corresponding to all directory requests obtained in 2), and obtaining all directories in the directory request information corresponding to the label;
4) Building a directory migration queue based on all the directories obtained in 3); and
5) Migrating all the directories in the directory migration queue obtained in 4) through particle swarm optimization (PSO);
wherein:
in 1), parsing each of the plurality of directory requests to obtain directory request information corresponding to the plurality of directory requests comprises: obtaining a first historical information dataset comprising I/O history records during DFS runtime based on the directory requests, preprocessing the first historical information dataset to remove features unrelated to the directory requests, to obtain a second historical information dataset that only contains features related to the directory requests; and parsing the second historical information dataset, to obtain the directory request information corresponding to the plurality of directory requests;
the machine learning model is a lightweight gradient boosting machine (LightGBM) model; and
the machine learning model is trained through the following steps:
2.1) collecting historical directory data for all storage nodes in DFS;
2.2) for the historical directory data of each storage node in DFS collected in 2.1), obtaining the directory request information corresponding to each directory;
2.3) for the historical directory data of each storage node in DFS collected in 2.1), processing the historical directory data to obtain directory status information corresponding to each directory;
2.4) for the historical directory data of each storage node in DFS collected in 2.1), normalizing the directory request information corresponding to all directories obtained in 2.2) to obtain normalized directory request information corresponding to each storage node; dividing the directory request information corresponding to all storage nodes and normalized directories into a training set and a testing set in a ratio of 6:4;
2.5) for each directory request information in the training set obtained in 2.4), calculating a directory hotness score corresponding to the directory request information;
2.6) obtaining minimum and maximum values of the directory hotness score corresponding to the directory request information in the training set obtained in 2.5), and dividing all directory hotness scores into K score intervals based on the maximum and minimum values, with each score interval corresponding to a label;
2.7) inputting K labels obtained in 2.6) and the directory request information corresponding to each directory in the historical directory data of each storage node in DFS obtained in 2.2) into the machine learning model for classification training, to obtain a preliminarily trained machine learning model; and
2.8) testing the preliminarily trained machine learning model obtained in 2.7) with the testing set obtained in 2.4), to obtain a trained machine learning model.
2. The method of claim 1, wherein the historical directory data of an i-th storage node in DFS comprises a current value Rc (i, r) of a resource dimension r at a current time of the i-th storage node in DFS and a maximum value Rt (i, r) of the resource dimension r of the i-th storage node in DFS, where r represents one of two resource dimensions of input/output operations per second (IOPS) and bandwidth, i represents the i-th storage node in DFS, and i∈(1, a total number of storage nodes in DFS is m), υ represents an average resource utilization of all storage nodes in DFS, and
υ
=
1
m
⁢
∑
i
=
1
m
⁢
R
c
(
i
,
r
)
R
t
(
i
,
r
)
;
in 2.3), an average IOPS and average bandwidth of each directory in the historical directory data of each storage node in DFS collected in 2.1) are calculated in sequence and used as the directory request information corresponding to the directory.
3. The method of claim 2, wherein in 2.5), the directory hotness score corresponding to the directory request information is calculated as follows:
HotnessScore
=
λ
×
F
+
1
-
λ
Δ
⁢
T
,
λ
∈
[
0
,
1
]
;
λ refers to a learned factor; F refers to access frequency to the directory, and ΔT refers to a mean value of the time intervals between every two access in a time window;
in 2.6), K is from 0 to 4, and each directory request information in the training set corresponds to K labels based on the score interval of the corresponding directory hotness score.
4. The method of claim 3, wherein in 4), building a directory migration queue based on all the directories comprises:
4.1) initializing a total capacity of directories included in the directory migration queue: Capacity=0;
4.2) determining whether the total capacity of the directory included in the directory migration queue is greater than or equal to a predetermined proportion of a storage node capacity in DFS; if so, ending step of 4.2), otherwise, proceeding to 4.3);
4.3) obtaining a current balance of DFS and determining if the current balance is greater than or equal to a preset threshold; if so, ending step of 4.3), otherwise, proceeding to 4.4);
4.4) adding all the directories obtained in 3) to the directory migration queue which is initially empty to obtain an updated directory migration queue;
4.5) performing statistical analysis on the updated directory migration queue in 4.4) to obtain status information of each directory in peer directories in the updated directory migration queue;
4.6) for each directory in the updated directory migration queue obtained in 4.4), obtaining an optimal adjustment factor α of the directory based on the status information of the directory in the peer directories in the updated directory migration queue obtained in 4.5);
4.7) for each directory in the updated directory migration queue obtained in 4.4), selecting α peer directories of the directory based on the optimal adjustment factor α of the directory obtained in 4.6), and determining if there is a correlation between the α peer directories; if so, proceeding directly to 4.8), otherwise setting α=0 and proceeding to 4.8);
4.8) for each directory in the updated directory migration queue obtained in 4.4), packaging the α peer directories of the directory into one object, and placing the object in the updated directory migration queue obtained in 4.4), to obtain a final directory migration queue; and
4.9) calculating a current capacity CapacityDirj of a j-th directory in the final directory migration queue, where j∈(1, a total number of directories in the final directory migration queue is num), setting a total directory capacity contained in the final directory migration queue to Capacity=Capacity+Capacity_Dir1+Capacity_Dir2+ . . . +Capacity Dirnum, and returning to 4.2).
5. The method of claim 4, wherein the current balance of DFS is calculated as follows:
Balance
=
υ
{
1
m
⁢
∑
i
=
1
m
⁢
(
R
c
(
i
,
r
)
R
t
(
i
,
r
)
-
υ
)
2
}
.
6. The method of claim 5, wherein in 4.6), the optimal adjustment factor α of the directory is obtained as follows: obtaining the IOPS of each directory in the updated directory migration queue, obtaining a first directory in the updated directory migration queue, and fitting multiple peer directories for the first directory to yield an IOPS curve; obtaining a directory number corresponding to a maximum slope change in the IOPS curve; defining a total number of directories in a horizontal axis of the IOPS curve before the directory number as the optimal adjustment factor α for the directory; for all remaining directories in the updated directory migration queue, repeating the above operations until all directories have been processed....

Claims

What is claimed is:
1. A method for preparing a poly(thioctic acid)-copper coating (poly(TA-Cu)) on a surface of a cardiovascular stent material, comprising:
grinding a cardiovascular stent material with sandpaper until a surface of the cardiovascular stent material is flat and smooth, rinsing the cardiovascular stent material with deionized water and anhydrous ethanol in sequence, and drying the cardiovascular stent material to obtain a pre-treated cardiovascular stent material;
dissolving thioctic acid in an alcoholic solvent, adding anhydrous copper chloride to a mixed solution of thioctic acid and the alcoholic solvent, stirring the mixed solution, to yield a precursor solution; treating the pre-treated cardiovascular stent material with the precursor solution, and drying, thus forming a poly(thioctic acid)-copper coating on the surface of the pre-treated cardiovascular stent material;
wherein:
a concentration of thioctic acid in the alcoholic solvent is 0.1-0.3 g/mL, and a molar ratio of anhydrous copper chloride to thioctic acid monomer is between 1:100 and 1:5000.
2. The method of claim 1, wherein the cardiovascular stent material is magnesium alloy, zinc alloy, iron alloy, 316L stainless steel, nickel titanium alloy, cobalt chromium alloy, or polylactic acid.
3. The method of claim 1, wherein the alcoholic solvent is anhydrous methanol or anhydrous ethanol.
4. The method of claim 1, wherein the cardiovascular stent material is treated with the precursor solution through dip coating, spin coating, or spray coating, to form the poly(thioctic acid)-copper coating on the surface of the pre-treated cardiovascular stent material.
5. The method of claim 1, further comprising disposing a magnesium fluoride conversion layer on the pre-treated cardiovascular stent material, which comprises submerging the pre-treated cardiovascular stent material into a hydrofluoric acid solution for 40-50 hours at 20-40° C., cleaning and drying a resulting product, to achieve the magnesium fluoride conversion layer on the pre-treated cardiovascular stent material; wherein the hydrofluoric acid solution has a concentration of 35-40 wt. %, and the poly(thioctic acid)-copper coating is formed on the magnesium fluoride conversion layer....

Claims

CLAIM
1. The ornamental design for a storage box as shown and described....

Claims

What is claimed is:
1. An air gun, comprising:
a cylinder;
a cartridge;
an air valve; and
a stop piece;
wherein:
the air valve comprises an assembly channel, a communication port, and an air passage connected to the assembly channel through the communication port;
the cartridge is disposed in the assembly channel and comprises an ejection channel communicating with the air passage through the communication port;
the stop piece is disposed on the air valve to push the cartridge towards the communication port, thereby locking the cartridge onto the air valve, and fitting the cartridge and the air valve at least at an outer circumference of the communication port; and
the cartridge comprises a first pin movable along the ejection channel to open and close the communication port.
2. The air gun of claim 1, wherein the cartridge is provided with two first seal rings; the two first seal rings are disposed on opposite sides of the communication port, and against an outer wall of the cartridge and an inner wall of the assembly channel, respectively.
3. The air gun of claim 2, wherein the outer wall of the cartridge comprises two seal grooves for receiving the two first seal rings, respectively; and the two first seal rings are embedded in corresponding seal grooves through interference fit.
4. The air gun of claim 1, wherein an outer wall of the cartridge comprises a locating groove, and the stop piece extends into the locating groove.
5. The air gun of claim 4, wherein a depth of the locating groove accounts for a quarter or one third of a wall thickness of the cartridge; and/or, one end of the stop piece against the cartridge is tapered, and a shape of the locating groove is corresponding to the one end of the stop piece against the cartridge.
6. The air gun of claim 5, wherein the air valve comprises a connection channel for the stop piece to extend into the assembly channel, and the stop piece comprises a threaded part in threaded connected to the connection channel and a butting part connected to the threaded part to push against the cartridge.
7. The air gun of claim 6, wherein the air valve comprises a connecting column extending radially outward from an outer wall of the air valve, and the connection channel is formed in the connecting column.
8. The air gun of claim 6, wherein the connection channel communicates with outside, and an axial length of the connection channel is not less than an axial length of the stop piece.
9. The air gun of claim 4, wherein the air valve comprises a connection channel for the stop piece to extend into the assembly channel, and the stop piece comprises a threaded part in threaded connected to the connection channel and a butting part connected to the threaded part to push against the cartridge.
10. The air gun of claim 9, wherein the air valve comprises a connecting column extending radially outward from an outer wall of the air valve, and the connection channel is formed in the connecting column.
11. The air gun of claim 9, wherein the connection channel communicates with outside, and an axial length of the connection channel is not less than an axial length of the stop piece.
12. The air gun of claim 1, wherein the air valve comprises a connection channel for the stop piece to extend into the assembly channel, and the stop piece comprises a threaded part in threaded connected to the connection channel and a butting part connected to the threaded part to push against the cartridge.
13. The air gun of claim 12, wherein the air valve comprises a connecting column extending radially outward from an outer wall of the air valve, and the connection channel is formed in the connecting column.
14. The air gun of claim 12, wherein the connection channel communicates with outside, and an axial length of the connection channel is not less than an axial length of the stop piece.
15. The air gun of claim 1, wherein a second seal ring is disposed on the ejection channel, and butts against an outer wall of the first pin and an inner wall of the ejection channel; and the cylinder comprises an inlet channel; the inlet channel communicates with the air passage through an intake port, and the air valve comprises a second pin capable of moving along the air passage to open and close the intake port.
16. The air gun of claim 15, wherein the air valve is an integrally-formed structure and comprises a first connector connected to the cylinder and a second connector connected to the cartridge; the first connector is partially disposed in the inlet channel and the air passage is disposed in the first connector; the second connector is disposed on the first connector and the assembly channel is disposed in the second connector; and the cartridge is disposed through the assembly channel of the second connector....

Claims

What is claimed is:
1. A method for preparing a curved blade of a centrifugal impeller, the centrifugal impeller comprising a disk and a cover, wherein the centrifugal impeller is centered around a rotating axis, the disk comprises a disk surface perpendicular to the rotating axis, and the cover comprises a cover surface perpendicular to the rotating axis; the method comprising:
S1) providing a primary blade, wherein the primary blade comprises an inlet edge, an outlet edge, a blade root, and a blade top; the inlet edge is disposed oppositely to the outlet edge; the blade root is disposed oppositely to the blade top; the blade root is adapted to be disposed along and connected to the disk surface, the blade top is adapted to disposed along and connected to the cover surface; the inlet edge and the outlet edge are disposed between the blade root and the blade top; the inlet edge is adapted to be disposed adjacent to the rotating axis with respect to the outlet edge; and a vertex is defined at a joint of the outlet edge and the blade top;
S2) forming a fold line on the primary blade, wherein the fold line comprises a first point and a second point; the first point is defined on the outlet edge; the second point is defined on the blade top; a first curve is formed on the outlet edge between the first point and the vertex; a second curve is formed on the blade top between the second point and the vertex; the first curve, the second curve, and the fold line enclose a bending region; and
S3) bending the bending region along the fold line towards the rotating axis to form the curved blade, while moving the second curve of the bending region along the cover surface.
2. The method of claim 1, wherein in S2), forming a fold line on the primary blade comprises:
S2-1) defining the first point; obtaining a camber line through the first point; drawing a first line segment on a tangent of the camber line passing through at the first point; rotating the first line segment about the first point within a normal plane of the first curve towards the rotating axis by a first angle to obtain a second line segment, wherein an endpoint of the first line segment is on one side of the first point away from the inlet edge;
S2-2) moving the second line segment from the first point to the vertex, thereby generating a profile; and
S2-3) rotating the profile about the second line segment towards the rotating axis by a second angle to intersect with the primary blade to form an intersection curve, referred to as the fold line.
3. The method of claim 2, wherein the first angle is between 3° and 10°.
4. The method of claim 2, wherein the second angle is between 3° and 6°.
5. The method of claim 1, wherein a length of the first curve is less than or equal to half a length of the outlet edge.
6. The method of claim 2, wherein in S3), the bending region is bent along the fold line towards the rotating axis, so as to coincide with the profile, thereby obtaining the curved blade.
7. The method of claim 1, wherein the fold line and the outlet edge are intersected with a plurality of camber lines, forming a plurality of curves; and lengths of the plurality of curves increase from the first point to the vertex.
8. The method of claim 7, wherein the primary blade is prepared by sheet metal stamping.
9. A curved blade, prepared according to the method of claim 1.
10. A centrifugal impeller, comprising a disk, a cover, and a plurality of the curved blades of claim 9, wherein the plurality of the curved blades is disposed between the disk and the cover; the disk is connected to the blade root of each of the plurality of the curved blades; and the cover is connected to the blade top of each of the plurality of the curved blades....

Claims

The invention claimed is:
1. A method for selective oxidation of macromolecular organic pollutants using free radicals produced in a heterogeneous Fenton reaction, the method comprising:
1) assembling a device, the device comprising a heterogeneous Fenton reaction unit and an electrochemical cell; the heterogeneous Fenton reaction unit comprising a reactor and an anion exchange membrane disposed in the reactor to separate the reactor into a first chamber and a second chamber; filling the first chamber with a catalyst; and filling the second chamber with a dielectric material;
2) providing wastewater containing hydrogen peroxide and hydroxylamine hydrochloride; and measuring an original pH of the wastewater; and
3) introducing the wastewater into the first chamber; connecting a power supply to the heterogeneous Fenton reaction unit; turning on the power supply, an electric field with an initial voltage is formed in the reactor, and organic acids generated by a heterogeneous Fenton solution in the reactor move from the first chamber into the second chamber.
2. The method of claim 1, wherein 3) further comprises monitoring a real-time pH of the wastewater in the first chamber and regulating the real-time pH of the wastewater by changing a voltage of the electric field.
3. The method of claim 1, wherein:
in 1), a water circulator is connected to the heterogeneous Fenton reaction unit;
in 2), the original pH of the wastewater is 3-6;
in 3), when the water circulator is turned on, the wastewater flows through the water circulator and the first chamber successively to form a fixed bed, and the heterogeneous Fenton reaction happens in the first chamber; when the power supply is turned on, an electric field with an initial voltage is formed in the reactor; the pH of the wastewater in the first chamber is monitored; when the pH exceeds the original pH, the voltage is regulated until the pH approaches to the original pH; and then the voltage returns to its initial value.
4. The method of claim 3, wherein an anode and a cathode are electrically connected to the power supply; the cathode is disposed in the first chamber; the anode is disposed in the second chamber; a distance between the cathode and the anode is less than or equal to 5 cm; and a maximum voltage of the eclectic field is less than or equal to 3 V.
5. The method of claim 4, wherein when the pH of the wastewater in the first chamber decreases by 1-2 compared to the original pH, the voltage of the electric field is increased by 0.1-0.2 V.
6. The method of claim 5, wherein the water circulator is a peristaltic pump;
when the initial voltage is 0.5-1 V, the peristaltic pump works at 50-100 rpm;
when the initial voltage is 1-2 V, the peristaltic pump works at 100-150 rpm; and
when the initial voltage is 2-3 V, the peristaltic pump works at 150-200 rpm.
7. The method of claim 1, wherein the wastewater comprises macromolecular organic pollutants which are degraded into low-molecular-weight organic acids through the heterogeneous Fenton reaction in the reactor....

Claims

What is claimed is:
1. A method for controlling an amount of a liquid carbon source released to a constructed wetland for treatment of polluted water using a system, the system comprising:
a carbon source pool, a carbon source pipe, a peristaltic pump, a programmable logic controller (PLC), a computer, a first flow meter, a first chemical oxygen demand (COD) sensor, a first total nitrogen (TN) sensor, a second TN sensor, a second COD sensor, an inlet pipe, and an outlet pipe; wherein:
the first flow meter, the first COD sensor, and the TN sensor are disposed on the inlet pipe; the second COD sensor and the second TN sensor are disposed on the outlet pipe; the inlet pipe and the outlet pipe are connected to the constructed wetland; the carbon source pipe is connected to the carbon source pool via the peristaltic pump; the computer, the peristaltic pump, the first flow meter, and all sensors are connected to the PLC; and
the first flow meter is configured to measure a flow of an influent to the constructed wetland; the first COD sensor is configured to monitor a concentration of COD in the influent (CODin); the first TN sensor is configured to monitor a concentration of TN in the influent (TNin); the second TN sensor is configured to monitor a concentration of TN in an effluent from the constructed wetland (TNout); and the second COD sensor is configured to monitor a concentration of COD in the effluent (CODout);
the method comprising:
S1. disposing the carbon source pipe in a water distribution channel in the constructed wetland;
S2. gathering aquatic plant straws from the constructed wetland; grinding the aquatic plant straws into powders; and soaking the powders in the carbon source pool; passing a resulting mixture through a filter so that the liquid carbon source is separated from carbon residues;
S3. receiving, by the PLC, data from the first flow meter, the first COD sensor, the first TN sensor, the second TN sensor, and the second COD sensor; and sending the data to the computer to calculate a preset volume (V) of the liquid carbon source to be released to the constructed wetland;
S4. calculating the preset volume (V) of the liquid carbon source released to the constructed wetland according to following formula:
V=(Q*(5*(TNin−TNout)−(CODin−CODout))/COD equivalent of carbon source from plant)/ρ;
wherein:
V is a volume of the liquid carbon source;
Q is a volume flow rate of the influent flowing into the constructed wetland (unit: m3/d);
ρ is a density of the liquid carbon source (unit: 1.0 g/mL);
when the influent has a ratio of CODin to TNin of greater than 6, the carbon source is not an impact factor hindering denitrification in the constructed wetland, and thus the liquid carbon source is not released; and
S5. sending the preset volume to the PLC; and controlling, by the PLC, operations of the peristaltic pump and a regulating valve connected to the peristaltic pump, so that the preset volume (V) of the liquid carbon source is added to the constructed wetland via the carbon source pipe; and monitoring, by a second flow meter disposed on the carbon source pipe and connected to the PLC, the flow of the liquid carbon source released to the constructed wetland.
2. The method of claim 1, wherein the computer acquires the data from an online monitoring device that monitors the flow, TNin, and CODin in real time....

Claims

What is claimed is:
1. A modified DNA polymerase, comprising a DNA polymerase fragment that maintains the DNA polymerase activity and a G-quadruplex binding peptide fused to the N-terminal of the DNA polymerase fragment.
2. The modified DNA polymerase of claim 1, wherein the G-quadruplex binding peptide comprises a RHAU23 peptide shown in SEQ ID NO: 1; or, the G-quadruplex binding peptide comprises a G4P peptide shown in SEQ ID NO: 2.
3. The modified DNA polymerase of claim 2, wherein the DNA polymerase fragment is resistant to temperatures above 40° C. and has activity at temperatures above 40° C.
4. The modified DNA polymerase of claim 3, wherein the DNA polymerase fragment is derived from any one of Bst DNA polymerase, Taq DNA polymerase and MMLV reverse transcriptase.
5. The modified DNA polymerase of claim 4, wherein the DNA polymerase fragment is derived from Bst DNA polymerase, and comprises an amino acid sequence shown in SEQ ID NO: 3.
6. The modified DNA polymerase of claim 4, wherein the DNA polymerase fragment is derived from Taq DNA polymerase, and comprises an amino acid sequence shown in SEQ ID NO: 4.
7. The modified DNA polymerase of claim 4, wherein the DNA polymerase fragment is derived from MMLV reverse transcriptase, and comprises an amino acid sequence shown in SEQ ID NO: 5.
8. A warm-start DNA polymerase, comprising the modified DNA polymerase of claim 1 and an aptamer comprising a G-quadruplex sequence; wherein the G-quadruplex of the aptamer binds to the G-quadruplex binding peptide of the modified DNA polymerase at a first preset temperature to inhibit the activity of the DNA polymerase, and detaches from the G-quadruplex binding peptide of the modified DNA polymerase at a second preset temperature to restore the activity of the DNA polymerase; and the second preset temperature is higher than the first preset temperature.
9. The warm-start DNA polymerase of claim 8, wherein the first preset temperature is 0° C.-30° C., and the second preset temperature is 45° C.-70° C.
10. A kit, comprising the warm-start DNA polymerase of claim 8.
11. The kit of claim 10, wherein the kit is used to detect human papilloma virus DNA or SARS virus RNA.
12. A method for biosynthesizing the modified DNA polymerase of claim 1, comprising:
inserting a nucleotide sequence encoding the DNA polymerase fragment into a plasmid vector to construct a first plasmid;
inserting a nucleotide sequence encoding the G-quadruplex binding peptide into the first plasmid 5′ to the nucleotide sequence encoding the DNA polymerase fragment so that the two nucleotide sequences are fused in frame, to construct a second plasmid;
transforming the second plasmid into an E. coli strain for culturing and inducing expression of a protein; and
purifying the protein to obtain the modified DNA polymerase.
13. The method of claim 12, wherein the DNA polymerase fragment is derived from residues 291-878 of DNA polymerase of Bacillus stearothermophilus, the plasmid vector is pCold-I, and the first plasmid is pCold-I-Bst-LF plasmid; the G-quadruplex binding peptide is G4P, and the second plasmid is pCold-I-G4P-Bst plasmid; or, the G-quadruplex binding peptide is RHAU23, and the second plasmid is pCold-I-RHAU23-Bst plasmid.
14. The method of claim 12, wherein the DNA polymerase fragment is derived from Taq DNA polymerase, the plasmid vector is pCold-I, and the first plasmid is pCold-I-Taq plasmid; the G-quadruplex binding peptide is G4P, and the second plasmid is pCold-I-G4P-Taq plasmid; or, the G-quadruplex binding peptide is RHAU23, and the second plasmid is pCold-I-RHAU23-Taq plasmid.
15. The method of claim 12, wherein the DNA polymerase fragment is derived from MMLV reverse transcriptase, the plasmid vector is pCold-I, and the first plasmid is pCold-I-RT plasmid; the G-quadruplex binding peptide is G4P, and the second plasmid is pCold-I-G4P-RT plasmid; or, the G-quadruplex binding peptide is RHAU23, and the second plasmid is pCold-I-RHAU23-RT plasmid.
16. A method for preparing the warm-start DNA polymerase of claim 8, the method comprising:
dissolving the aptamer in a first buffer, denaturing at 90° C.-100° C. for 2 min to 8 min, cooling to 20° C.-30° C. to obtain a treated aptamer; and
adding the modified DNA polymerase and the treated aptamer to a second buffer at a preset molar concentration ratio, and incubating at 2° C.-6° C. for 30 min to 60 min;
optionally wherein:
the first buffer comprises 10 mM Tris-HCl (pH 7.4), 75 mM KCl, 0.5 mM EDTA and 0.2 mg/ml bovine serum albumin, and the second buffer comprises 20 mM Tris-HCl (pH 8.8), 10 mM (NH4) 2SO4, 50 mM KCl, 2-8 mM MgSO4, and 0.10% Tween-20.
17. The method of claim 16, wherein the preset molar concentration ratio of the modified DNA polymerase to the aptamer is between 1:8 and 1:1.
18. A method for detecting or synthesizing a nucleic acid comprising contacting the warm-start DNA polymerase of claim 8 with reagents required for detecting or synthesizing of the nucleic acid.
19. The method of claim 18, wherein the nucleic acid is a human papilloma virus DNA or SARS-COV-2 virus RNA....

Claims

What is claimed is:
1. A disc motor, comprising:
a stator assembly; and
a rotor assembly, the rotor assembly comprising a rotor core, a first set of magnetic tiles, and a second set of magnetic tiles;
wherein:
the stator assembly is coupled to the rotor assembly through an axial magnetic field;
the first set of magnetic tiles is disposed on the rotor core along a first circumference and magnetized;
the second set of magnetic tiles is disposed on the rotor core along a second circumference and magnetized tangentially;
the first set of magnetic tiles is disposed near the stator assembly, and the second set of magnetic tiles is disposed away from the stator assembly;
the first set of magnetic tiles is axially staggered with the second set of magnetic tiles at a distance of L3;
the first set of magnetic tiles comprises N first magnetic tiles disposed uniformly along the first circumference, and the second set of magnetic tiles comprises N second magnetic tiles disposed uniformly along the second circumference, where N is an integer;
a first centerline L1 is formed between every two adjacent first magnetic tiles, and each second magnetic tile comprises a second centerline L2; the first centerline L1 is offset from the second centerline L2 in a circumferential direction, which reduces an electrical angle difference between a first current angle corresponding to a maximum permanent magnet torque and a second current angle corresponding to a maximum reluctance torque, thereby increasing a maximum output torque of the disc motor;
the first centerline L1 is offset from the second centerline L2 in the circumferential direction by an offset angle α;
each first magnetic tile has a cross section in the shape of a sector, and each second magnetic tile has a square cross section;
the rotor core comprises a first annular end plate, a second annular end plate, a plurality of iron block portions, and a plurality of connecting portions; the plurality of connecting portions is evenly disposed along a circumference between the first annular end plate and the second annular end plate to connect the first annular end plate and the second annular end plate together; a first mounting slot is formed between every two adjacent connecting portions; each first magnetic tile is inserted into a corresponding first mounting slot; and
the plurality of the iron block portions are uniformly disposed and protrudes along the circumference from a bottom part of the second annular end plate; a second mounting slot is formed between every two adjacent iron block portions; and each second magnetic tile is inserted into a corresponding second mounting slot.
2. The disc motor of claim 1, wherein a first air-gap magnetic barrier is formed between each of two sides of the first magnetic tile and an adjacent connecting portion; and a second air-gap magnetic barrier is formed between each of the first magnetic tiles and a top of the second mounting slot.
3. The disc motor of claim 2, wherein each of the connecting portions comprises a through hole extending radially along the rotor core; and the through hole functions as a third air-gap magnetic barrier.
4. The disc motor of claim 3, wherein the first set of magnetic tiles comprises eight first magnetic tiles evenly disposed along the first circumference, and the second set of magnetic tiles comprises eight second magnetic tiles evenly disposed along the second circumference.
5. The disc motor of claim 4, wherein the offset angle α ranges between 6°-7°; and the electrical angle difference between the first current angle corresponding to the maximum permanent magnet torque and the second current angle corresponding to the maximum reluctance torque is between 7.5°-12.5°....

Claims

The invention claimed is:
1. A base material, comprising: a first structural layer, a second structural layer located at least on one surface of the first structural layer; the second structural layer comprising:
a) a first protrusion portion, wherein the first protrusion portion extends along one length direction of the second structural layer;
b) a first concave portion that extends substantially in the same direction as the first protrusion portion and is adjacent to the first protrusion portion; and
c) a plurality of holes distributed in the first protrusion portion;
at least 0.05% of the holes communicate with adjacent first concave portions; and
the first structural layer comprises at least one transition metal at a content of at least 90%, and the second structural layer comprises an oxide of the transition metal at a content of at least 30%.
2. The base material of claim 1, wherein the base material is flexible in at least one direction; the base material has a bending angle of not less than 90°; and the base material has a bulk density not higher than 1 g/cm3.
3. The base material of claim 1, wherein the base material is prepared by using transition metal flakes as raw materials;
a plurality of concave and convex stripes with a substantially uniform direction is disposed on the transition metal flakes, and cross-sections of the concave and convex stripes have a mesoscopic scale; and
a transition metal oxide film is formed on surfaces of the transition metal flakes, and has a hole array consistent with a direction of the concave and convex stripes; and the holes have an aperture of mesoscopic scale or an aperture of nanometer and/or micron scale.
4. The base material of claim 3, wherein
the transition metal oxide film and the hole array thereon is formed by performing anodizing treatment on the transition metal flakes; and
the second structural layer is formed by performing an etching treatment on the transition metal oxide film and the hole array thereon....

Claims

What is claimed is:
1. A loading/unloading system for a container terminal, the system comprising: a plurality of shore cranes, an operation lane area between two rails of the shore cranes, an automatic container yard area, an operation area from a rear side of a landside rail of the shore cranes to the automatic container yard area, and facilities behind the automatic container yard area;
wherein:
the operation lane area between two rails of the shore cranes comprises a lambdoidal reverse operation area of inner container trucks, a ship lofting operation area, and a loading/unloading operation area of the inner container trucks, which are physically isolated by fences;
the operation area from the rear side of the landside rail of the shore cranes to the automatic container yard area comprises a hatch cover area, an unlocking and locking area of the inner container trucks, an unlocking and locking buffer area, a passing area of the inner container trucks and a charging area of the inner container trucks, which are not physically isolated, thereby facilitating cooperation among the areas in operation;
the automatic container yard area comprises yards and a plurality of automatic rail-mounted gantry cranes disposed in parallel to the yards;
the facilities behind the automatic container yard area comprise intelligent arrival and departure gates, an in-yard parking lot and an auxiliary building area; and
the container terminal is arranged in a quay layout.
2. The system of claim 1, wherein the ship lofting operation area and the loading/unloading operation area of the inner container trucks are independent and are isolated by the fences.
3. The system of claim 1, wherein the hatch cover area is used to stack hatchway covers of ships, or used as a parking area of the inner container trucks without operation.
4. The system of claim 1, wherein the lambdoidal reverse operation area of the inner container trucks is for realizing reverse operation of the containers.
5. A loading/unloading method for the container terminal using the system of claim 1, the method comprising:
S1: shipping and unshipping operation: during unshipping, unloading containers from a container ship by utilizing the plurality of shore cranes, transferring the containers to target operation positions of the yards, then hoisting, by the automatic rail-mounted gantry cranes, the containers to appointed locations, and allowing the inner container trucks to continuously enter a next operation cycle, where containers carrying hazardous goods are transferred by shore crane trolleys to the outer container trucks waiting in the ship lofting operation area and are directly transported out of the terminal area by the outer container trucks along a regulated route; and during unshipping, carrying out reverse operations as that during unshipping; and
S2: container collecting and dispatching operations: in a collecting process, allowing the outer container trucks to drive from arrival and departure gates and a parking lot and further to enter appointed positions of the operation area of the yards, hoisting, by the automatic rail-mounted gantry cranes, the containers to appointed locations, and allowing the outer container trucks unloading the containers to continuously leave a harbor district; and during container dispatching, carrying out reverse operations as that during container collecting....

Claims

What is claimed is:
1. A telescopic stool, comprising:
a first connection ring;
a second connection ring;
a plurality of clamping seats;
a plurality of anti-deformation members; and
a plurality of tightening members;
wherein:
the second connection ring is disposed on an upper part of an inner side of the first connection ring;
the plurality of clamping seats are equidistantly disposed on a lower part of an inner side of the second connection ring;
the plurality of anti-deformation members is clamped on the plurality of clamping seats, respectively;
the plurality of tightening members is disposed on the plurality of clamping seats, respectively;
each of the plurality of anti-deformation members comprises an active connection seat, a fixed block, a first active clamping block, an active connection rod, a second active clamping block, a support block, an elastic spring, and a fixed support rod;
the active connection seat is clamped on the plurality of clamping seats;
the fixed block is fixed on one end of the active connection seat;
the first active clamping block is rotatably connected to the fixed block;
the first active clamping block is fixedly connected to one end of the active connection rod, and the other end of the active connection rod is fixedly connected to the second active clamping block; the second active clamping block is rotatably connected to the support block; each support block is fixedly connected to two fixed support rods, and each fixed support rod is disposed through the upper part of the first connection ring.
2. The telescopic stool of claim 1, wherein two adjacent ends of two adjacent second active clamping blocks are fixedly connected to two ends of the elastic spring, respectively; bottom ends of two adjacent first active clamping blocks are fixedly connected to two ends of an elastic rope.
3. The telescopic stool of claim 1, wherein the plurality of tightening members each comprise a connection seat, an L-shaped clamp rod, a threaded connecting rod, and a threaded fastening cap; the connection seat is disposed on the active connection seat and is located at an outer bottom of the second connection ring; the L-shaped clamp rod is disposed on two top sides of the connection seat; the threaded connecting rod is fixedly connected to a front end to the L-shaped clamp rod; and the threaded connecting rod is disposed through the upper part of the first connection ring and in threaded connection to the threaded fastening cap.
4. The telescopic stool of claim 1, wherein two press blocks are fixedly connected to two sides of a front end of the fixed support rod, respectively, and the two press blocks are disposed on the upper part of the first connection ring in the vicinity of the fixed support rod; and the two press blocks and the first connection ring are detachably connected to fourth anchor bolts.
5. The telescopic stool of claim 1, wherein the active connection seat is detachably connected to each of the plurality of clamping seats through a first anchor bolt.
6. The telescopic stool of claim 1, wherein the first active clamping block is detachably connected to the fixed block through a second anchor bolt.
7. The telescopic stool of claim 1, wherein the second active clamping block is detachably connected to the support block through a third anchor bolt....

Claims

What is claimed is:
1. A folding table, comprising:
a table top comprising a bottom;
a plurality of table legs hinged to the table top;
a plurality of folding stools detachably fixed to the bottom of the table top; and
a plurality of folding support bars disposed between the table top and the table legs;
wherein:
the folding support bars comprise first support bars pivotally connected to the table legs and second support bars pivotally connected to the table top;
the first support bars are hinged to the second support bars; a clamping part is disposed between each first support bar and each second support bar to position the first support bar and the second support bar when the folding table is in an unfolding state; and
the plurality of table legs comprise a first pair of table legs and a second pair of table legs; the first pair of table legs each comprise an arc-shaped part, and in a folding state, the first pair of table legs and the second pair of table legs are overlapped on the bottom of the table top, and the first pair of table legs are covered by the second pair of table legs.
2. The folding table of claim 1, further comprising a connection board disposed on the bottom of the table top, and the plurality of table legs being hinged to the connection board.
3. The folding table of claim 1, wherein a first fixed rod is disposed between the first pair of table legs, and a second fixed rod is disposed between the second pair of table legs.
4. The folding table of claim 3, wherein the first fixed rod is disposed on an inner side of the first pair of table legs, and the second fixed rod is disposed on an outer side of the second pair of table legs.
5. The folding table of claim 3, wherein both the first fixed rod and the second fixed rod comprise a cushion block; and when the folding table is in a folding state, the cushion block is in contact with the folding stools.
6. The folding table of claim 5, wherein the cushion block comprises a head for fixing the folding stools, a tail, and a connection part connecting the head and the tail; the tail is cone-shaped; the connection part comprises an annular groove; the first fixed rod and the second fixed rod comprise a plurality of through holes; the tail is disposed through the through holes, and the connection part is embedded in the through holes of the first fixed rod and the second fixed rod.
7. The folding table of claim 1, wherein both the first pair of table legs and the second pair of table legs comprises fasteners, and when the folding table is in a folding state, the first pair of table legs and the second pair of table legs are locked by the fasteners.
8. The folding table of claim 1, wherein the bottom of the table top comprises a fixed belt; and the fixed belt is an elastic rope configured to fix the folding stools on the bottom.
9. The folding table of claim 1, wherein the clamping part is disposed on the first support bar; the second support bar comprises a recess matched with the clamping part; in an unfolding state, the clamping part is embedded in the recess to limit the rotation of the table legs.
10. The folding table of claim 1, wherein the first support bar comprises a first lower locating hole and a first upper locating hole; the second support bar comprises a second upper locating hole and a second lower locating hole; the second support bar is hinged to the table top through the second upper locating hole; the first support bar is hinged to the table legs through the first lower locating hole; and the first support bar is hinged to the second support bar through the first upper locating hole and the second lower locating hole.
11. The folding table of claim 10, wherein the first support bar further comprises two protrusions disposed equidistantly at two sides of the first upper locating hole; the second support bar comprises a fixing hole; when the folding table is in a folding or unfolding state, one of the two protrusions is limited in the fixing hole.
12. A folding table, comprising:
a table top comprising a bottom;
a plurality of table legs hinged to the table top;
a plurality of folding stools detachably fixed to the bottom of the table top; and
a plurality of folding support bars disposed between the table top and the table legs;
wherein:
the folding support bars comprise first support bars pivotally connected to the table legs and second support bars pivotally connected to the table top;
the first support bars are hinged to the second support bars; a clamping part is disposed between each first support bar and each second support bar to position the first support bar and the second support bar when the folding table is in an unfolding state; and
the bottom of the table top comprises a plurality of grooves and a locating block disposed in each groove; the folding stools are disposed in grooves one by one; and the folding stools each comprise a positioning groove matched with the locating block.
13. The folding table of claim 12, further comprising a connection board disposed on the bottom of the table top, and the plurality of table legs being hinged to the connection board.
14. The folding table of claim 12, wherein the bottom of the table top comprises a fixed belt; and the fixed belt is an elastic rope configured to fix the folding stools on the bottom.
15. The folding table of claim 12, wherein the clamping part is disposed on the first support bar; the second support bar comprises a recess matched with the clamping part; in an unfolding state, the clamping part is embedded in the recess to limit the rotation of the table legs.
16. The folding table of claim 12, wherein the first support bar comprises a first lower locating hole and a first upper locating hole; the second support bar comprises a second upper locating hole and a second lower locating hole; the second support bar is hinged to the table top through the second upper locating hole; the first support bar is hinged to the table legs through the first lower locating hole; and the first support bar is hinged to the second support bar through the first upper locating hole and the second lower locating hole.
17. The folding table of claim 16, wherein the first support bar further comprises two protrusions disposed equidistantly at two sides of the first upper locating hole; the second support bar comprises a fixing hole; when the folding table is in a folding or unfolding state, one of the two protrusions is limited in the fixing hole....

Claims

What is claimed is:
1. An air gun, comprising:
a cartridge comprising a launching chamber;
a cylinder comprising an air chamber;
an air valve;
a first pin; and
a second pin;
wherein:
the air valve is disposed in the air chamber and partially extends out of the cylinder to connect to the cartridge;
the air valve is a single, integrally formed structure and comprises a first connection column, a second connection column, and a connection block; the connection block is connected to the first connection column and the second connection column and is integrally formed with the first connection column and the second connection column; and an air passage comprising an air inlet and an air outlet is disposed within the air valve;
the air passage further comprises a first passage, a second passage, and a third passage; the first passage axially extends within the first connection column; the third passage axially extends within the second connection column; and the second passage extends through the connection block and communicates the first passage with the third passage;
the first connection column is disposed in the air chamber and detachably connected to the cylinder, and the second connection column is detachably connected to the cartridge;
the air inlet is configured to communicate the air chamber with the first connection column;
the air outlet is configured to communicate the launching chamber with the second connection column; and
the first pin is disposed through the first connection column and is movable relative to the cylinder to open and close the air inlet;
the cartridge extends axially into the second connection column from a first opening of the third passage;
the second pin has a solid structure and extends axially into the second connection column from a second opening of the third passage; and
a sliding seat is disposed on the cylinder; the second pin is connected to the sliding seat; the sliding seat is movable between a first position and a second position;
when the sliding seat is in the first position, the second pin is positioned within the launching chamber and closes the air outlet; and when the sliding seat is in the second position, the second pin is retracted from the launching chamber and opens the air outlet.
2. The air gun of claim 1, wherein an outer circumference of the first connection column comprises a plurality of counterbores; the cylinder comprises a plurality of through holes corresponding to the plurality of counterbores one by one; a fastener is disposed in each of the plurality of through holes; and the fastener is configured to fix and position the first connection column on the cylinder.
3. The air gun of claim 2, wherein the first passage is disposed through the first connection column, and a first driving unit and a second driving unit are disposed axially on two ends of the first passage, respectively; the second driving unit is movable along the cylinder between a third position and a fourth position; in the third position, the second driving unit butts against the first pin and the first pin opens the air inlet; in the fourth position, the second driving unit is disconnected with the first pin, and the first pin closes the air inlet.
4. The air gun of claim 3, wherein when the first pin closes the air inlet, one end of the first pin away from the first driving unit extends out of the first connection column; when the second driving unit moves from the fourth position to the third position, the second driving unit drives the first pin to open the air inlet.
5. The air gun of claim 3, wherein the first driving unit comprises a connecting cylinder and a first elastic piece; the connecting cylinder is in threaded connection to the connection column and comprises a first assembly chamber; the first assembly chamber communicates with the first passage and the air chamber; the first elastic piece is disposed in the first assembly chamber and butts against the first pin; the first elastic piece is elastically contractive in a movement direction of the first pin, to drive the first pin to move towards the second driving unit and extend out of the connection column.
6. The air gun of claim 3, wherein the second driving unit comprises a sliding block and a second elastic piece; the sliding block comprises a second assembly chamber; the second assembly chamber is opened on one side of the sliding block away from the first pin, and the second elastic piece is disposed in the second assembly chamber and butts against the cylinder; a trigger is disposed on the cylinder and is rotatable with a joint of the trigger and the cylinder as an axis to engage with or detach from the sliding block; when the trigger detaches from the sliding block, the sliding block is driven by the second elastic piece to butt against the first pin, and the first pin moves to open the air inlet; when the trigger engages with the sliding block, the sliding block detaches from the first pin, and the first pin is driven by the first driving unit to move and close the air inlet.
7. The air gun of claim 2, wherein a sealing sleeve is disposed in the first passage; the sealing sleeve surrounds the first pin and is adjacent to the air inlet; an outer wall of the sealing sleeve comprises an annular groove, and a seal ring is disposed in the annular groove....

Claims

What is claimed is:
1. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
the mechanical driver further comprises a transmission gear coaxially disposed with the rotation disc; the guide disc is meshed with the transmission gear and comprises a plurality of protrusion groups; the plurality of protrusion groups are radially spaced apart on the guide disc; each of the plurality of protrusion groups comprises a plurality of protrusions circumferentially spaced apart on the guide disc; the plurality of protrusions in a first protrusion group are misaligned with the plurality of protrusions in a second protrusion group in a circumferential direction of the guide disc to form a plurality of gaps; the second protrusion group is adjacent to the first protrusion group, and each gap allows a single ammunition round to pass through one time.
2. The mechanical magazine of claim 1, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
3. The mechanical magazine of claim 2, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
4. The mechanical magazine of claim 1, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc.
5. The mechanical magazine of claim 3, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
6. The mechanical magazine of claim 1, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
7. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
the mechanical driver further comprises a transmission gear coaxially disposed with the rotation disc and meshed with the guide disc; an acceleration gear is meshed with the guide disc; the acceleration gear comprises an eccentric wheel; when the energy storage unit releases energy, the eccentric wheel is configured to swing, to speed up the rotation of the rotation disc towards the ammunition outlet.
8. The mechanical magazine of claim 7, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc.
9. The mechanical magazine of claim 7, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
10. The mechanical magazine of claim 9, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
11. The mechanical magazine of claim 10, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
12. The mechanical magazine of claim 7, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
13. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
a turntable is disposed on one side of the conversion space facing the rotation disc; and the turntable comprises elastic material.
14. The mechanical magazine of claim 13, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
15. The mechanical magazine of claim 14, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
16. The mechanical magazine of claim 15, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
17. The mechanical magazine of claim 13, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
18. The mechanical magazine of claim 13, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc....

Claims

What is claimed is:
1. A method for extending shelf life of germ-remained rice, the method comprising:
1) evenly spreading the germ-remained rice on a sheet tray, and moderately moistening the germ-remained rice; and
2) packing the germ-remained moistened rice, and irradiating the germ-remained rice with an electron beam; and
wherein moderately moistening comprises transferring the sheet tray to a constant climate chamber, and moistening the germ-remained rice at a temperature of 20-30° C. and a relative humidity of 88-99% for 1.0-2.0 hours without spraying water, until moisture seeps through the germ-remained rice; and
the germ-remained rice is germ-remained indica rice or germ-remained japonica rice;
the germ-remained indica rice is moistened to a moisture content of not more than 14.5%, and the germ-remained japonica rice is moistened to a moisture content of not more than 15.5%; and
wherein the germ-remained rice moistened is irradiated with an electron beam at a dose of 0.5 to 1.0 kGy and stored at 25° C. from 75-120 days.
2. The method of claim 1, wherein in 1), the germ-remained rice has a germ retention rate of more than or equal to 80%.
3. The method of claim 1, wherein in 1), the germ-remained rice is evenly spread on the sheet tray to a thickness of equal to or less than 2 cm.
4. The method of claim 1, wherein in 2), packing comprises sealing the moistened germ-remained rice in a bag without removing the air; and the germ-remained rice is evenly spread in the bag to a thickness of not more than 1 cm.
5. The method of claim 4, wherein the bag comprises nylon composite.
6. Germ-remained rice treated by the method of claim 1....

Claims

What is claimed is:
1. A few-shot urban remote sensing image information extraction method based on meta learning and attention, the method comprising:
step 1, building a few-shot urban remote sensing information pre-trained model, wherein during a pre-training stage, pre-training network learning is performed for a few-shot set to fully learn feature information of existing samples and obtain initial feature parameters and a deep convolutional network backbone of the few-shot set; the few-shot urban remote sensing information pre-trained model is a network structure comprising a convolutional layer, a pooling layer and a fully-connected layer, and comprises five sections of convolutional network where each section comprises two or three convolutional layers, and an end of each section is connected to one maximum pooling layer to reduce a size of a picture; the number of convolutional kernels inside each section is same, and when closer to the fully-connected layer, the number of convolutional kernels is larger;
step 2, constructing a “time-space-spectrum-angle” attention model to enable the pre-training network to focus on important “time-space-spectrum-angle” information in a training process, suppress noise and redundant information, and improve classification performance of the pre-training model;
step 3, establishing a synergy mechanism of meta learning and attention and realizing few-shot urban remote sensing information extraction, performing parallel association learning for feature parameters obtained by the “time-space-spectrum-angle” attention model and initial feature parameters and introducing a regularizer to minimize cross entropy and structural risk and realize full digging for few-shot information; and
step 4, obtaining remote sensing data through a satellite and fusing a full color image and a multi-spectral image to obtain a multi-spectral image, and using the above three steps to perform urban ground feature information extraction; wherein:
a feature vector of the “time-space-spectrum-angle” is obtained in the following formula:
k
i
′
⇐
k
i
-
η
⁢
∇
k
i
∇
k
i
=
∑
j
=
1
n
⁢
1
[
y
=
i
]
⁢
(
k
i
-
e
j
,
l
)
sum
(
1
[
y
=
i
]
)
v
i
⇐
v
i
-
η
⁢
∇
v
i
∑
j
=
1
C
⁢
(
v
i
,
j
-
η
⁢
∇
v
i
,
j
)
∇
v
i
=
∑
j
=
1
n
⁢
1
[
y
=
i
]
⁢
(
v
i
-
p
j
,
l
)
sum
(
1
[
y
=
i
]
)
wherein ki represents a final category feature center of an i-th category, ki represents an initial category feature center of the i-th category, ∇ represents a gradient, ∇ki represents a gradient-optimized category feature center of the i-th category, j represents a number of unlabeled samples, I represents a number of labeled samples, ej,i represents a feature corresponding to the labeled samples and the unlabeled samples, sum ( ) represents a sum of values in parentheses, vi represents a probability distribution feature center of the i-th category, vi,j represents probability distribution feature centers of the i-th category obtained by updating category probability vectors of j samples of the i-th category, n represents a total number of samples, C represents a number of categories in a dataset, e represents an initial feature vector, p represents a “time-space-spectrum-angle” feature vector, Pj,l represents a prediction probability corresponding to the labeled samples of the l-th category and the unlabeled samples of the j-th category, n represents an update coefficient, and 1(y=i) represents an indicator function.
2. The method of claim 1, wherein the five sections of convolutional network in the few-shot urban remote sensing information pre-trained model is implemented as follows:
a first section of convolutional network comprises two convolutional layers and one maximum pooling layer, with an output channel number being 64 and an output size being 112×112×64;
a second section of convolutional network comprises two convolutional layers and one maximum pooling layer, with an output channel number being 128 and an output size being 56×56×128;
a third section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 256 and an output size being 28×28×256;
a fourth section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 512 and an output size being 14×14×512;
a fifth section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 512 and an output size being 7×7×512;
wherein results output by the five sections of convolutional network are represented as one-dimensional vector in a flattened manner and then input into a Dropout layer corresponding to a first fully-connected layer and then input into a Dropout layer corresponding to a second fully-connected layer and finally input into a third fully-connected layer, wherein an output node of the third fully-connected layer is 1000; and the third fully-connected layer obtains a classification output probability and a classification result by using softmax function at the same time.
3. The method of claim 1, wherein in the “time-space-spectrum-angle” attention model, for a three-dimensional input X, two feature-compressed global feature descriptions are obtained firstly through maximum pooling and average pooling along a channel dimension; then, by a gate mechanism of hard-sigmoid, a weight Xss € (0,1) of a temporal feature, a spatial feature, a spectral feature and an angular feature is obtained; finally, the original input X is multiplied by the weight Xss;
continuous learning is performed by the network in a training process, and a weight corresponding to the important “time-space-spectrum-angle” information approaches 1; and a weight corresponding to non-important or negative noise and redundant information approaches 0.
4. A few-shot urban remote sensing image information extraction system based on meta learning and attention, comprising a processor and a memory, wherein the memory is configured to store program instructions and the processor is configured to invoke the program instructions stored in the memory to perform the few-shot urban remote sensing image information extraction method based on meta learning and attention of claim 1.
5. A few-shot urban remote sensing image information extraction system based on meta learning and attention, comprising a non-transitory computer-readable storage medium, wherein the non-transitory computer-readable storage medium stores computer programs which are executed to perform the few-shot urban remote sensing image information extraction method based on meta learning and attention of claim 1....

Claims

What is claimed is:
1. A method for preparing a carrier for a mercury adsorbent, the method comprising:
1) Mixing hydrated alumina with an organic acid to obtain a mixture A, wherein the organic acid is ethylenediaminetetraacetic acid; and
2) Adding tetraalkylsiloxane to the mixture A, thus obtaining a mixture B; stirring the mixture B in a closed condition; spraying atomized water into the mixture B; and stirring to yield the carrier.
2. The method of claim 1, wherein in 1), hydrated alumina is mixed with the organic acid at −10° C. to 40° C.
3. The method of claim 1, wherein in 1), the organic acid is 1%-10% by mass of the hydrated alumina in the mixture A.
4. The method of claim 3, wherein the organic acid is 6% by mass of the hydrated alumina in the mixture A.
5. The method of claim 1, wherein in 2), the tetraalkylsiloxane is 3%-15% by mass of the hydrated alumina.
6. The method of claim 1, wherein the tetraalkylsiloxane is tetramethylsiloxane or tetraethoxysilane.
7. The method of claim 1, wherein the atomized water is 3-8 times tetraalkylsiloxane by mass.
8. The method of claim 1, wherein in 2), the atomized water is added and stirred for 1-24 h....

Claims

What is claimed is:
1. A method for inhibiting in vivo tumor metastasis within a patient, the method comprising:
A) identifying key heterogeneous molecules driving that drive tumor metastasis by using a prediction system to obtain a sorted list of heterogeneous molecules, the prediction system comprising a non-transitory computer readable storage medium having computer instructions stored in the medium and a processor for executing the computer instructions, identifying the key heterogeneous molecules that drive tumor metastasis by using the prediction system to obtain a sorted list of heterogeneous molecules comprising:
(1) inputting a first quantitative analysis result of proteins and a second quantitative analysis result of proteins to the prediction system; the first quantitative analysis result of proteins is a collection of quantitative analysis results of various protein expression levels in tumor metastases of the patient before drug intervention, and the second quantitative analysis result of proteins is a collection of quantitative analysis results of various protein expression levels in residual tumor metastases of the patient after drug intervention;
(2) comparing, by using the prediction system, the first quantitative analysis result of proteins and the second quantitative analysis result of proteins, and including proteins with expression changes within a predetermined range in a candidate protein set;
(3) constructing, by using the prediction system to employ a protein interaction network analysis tool, experimentally validated protein interaction networks based on the candidate protein set, supplementing the protein interaction networks by utilizing signal pathways of the candidate protein; including most important proteins in each protein interaction network as independent heterogeneous molecules in an independent molecular set; constructing, by using the prediction system to employ a protein interaction network prediction tool and based on the candidate protein set, a protein interaction prediction network according to a protein interaction law; and including proteins in the candidate protein set that do not participate in any protein interaction prediction network as independent heterogeneous molecules in the independent molecular set; and
(4) calculating, by using the prediction system, a hazard ratio (HR) value of each heterogeneous molecule in the independent molecular set, and sorting the heterogeneous molecules based on the HR value, to form the sorted list of heterogeneous molecules; and
B) conducting a sequential intervention on the heterogeneous molecules within the patient by administering to the patient, in sequence, inhibitors or agonists that respectively target the heterogeneous molecules according to an order in the sorted list of heterogeneous molecules, thereby inhibiting in vivo tumor metastasis within the patient.
2. The method of claim 1, wherein the first quantitative analysis result of proteins and the second quantitative analysis result of proteins are acquired through high-throughput protein sequencing; and the high-throughput protein sequencing comprises protein mass spectrometry analysis.
3. The method of claim 1, wherein the proteins with expression changes within the predetermined range are proteins whose expression levels after drug intervention are 0.95-1.05 times higher than those before drug intervention.
4. The method of claim 1, wherein the proteins with expression changes within the predetermined range are first screened and then included in the candidate protein set; the proteins that are screened meet the following conditions: a number of specific peptide segments is ≥2, and is not a predicted protein; a coverage of amino acids of identified peptide segments of a current protein is ≥10%; a quantification frequency of the current protein is ≥2, and a sequencing quality comprehensive score of the current protein is ≥200; evidence in a database shows the current protein is related to tumor progression; the specific peptide segments refer to a specific peptide segment used to identify the current protein; the predicted protein refers to an attribute that defines a reliability of the current protein in Uniport or National Center for Biotechnology Information (NCBI) databases as a predicted protein; the identified peptide segments refer to a specific peptide segment that can be used to indicate the current protein being detected; the quantification frequency of the current protein refers to a number of repetitions of the current protein being quantitatively detected.
5. The method of claim 1, wherein the protein interaction network analysis tool comprises a STRING network tool; the system further comprises a signal pathway database for accessing the signal pathways of the candidate protein, and the signal pathway database comprises Kyoto Encyclopedia of Genes and Genomes (KEGG), Small Molecule Pathway Database (SMPDB), WikiPathways, Cell Signaling Technology, BioCarta Pathway, Pathway Commons, and Pathway Interaction Database (PID); the protein interaction network prediction tool comprises a Gene Multiple Association Network Integration Algorithm (GeneMANIA) network tool, Unified Human Interactome (UniHI) network tool, and Hitpredict network tool.
6. The method of claim 5, wherein the system further comprises a Cytoscape tool for constructing and supplementing the protein interaction networks, and for constructing a protein interaction prediction network.
7. The method of claim 1, wherein the most important proteins in each protein interaction network are identified through characteristic analysis; the characteristic analysis comprises analyzing the importance, degree, and radiancy of each protein in the protein interaction network; and proteins with the highest importance, degree, and radiancy are the most important proteins in the protein interaction network.
8. The method of claim 1, wherein during the calculating and sorting, the HR value of each heterogeneous molecule is calculated as follows: obtaining sequencing data of tumors from a public database, obtaining a standardized counting matrix of genes corresponding to the heterogeneous molecules from the sequencing data, and performing batch single factor Cox regression on the genes to obtain the HR value.
9. The method of claim 8, wherein the public database comprises The Cancer Genome Atlas (TCGA), International Cancer Genome Consortium (ICGC), and Gene Expression Omnibus (GEO).
10. The method of claim 1, wherein during the calculating and sorting, a sorting rule is: the heterogeneous molecules with HR values greater than or equal to 1 are directly sorted in reverse order according to their HR values, and the heterogeneous molecules with HR values less than 1 are sorted in reverse order according to their 1/HR values....

Claims

What is claimed is:
1. A rotor for a disc permanent magnet motor, comprising:
a first rotor core;
a second rotor core; and
a plurality of magnetic tiles;
wherein:
the first rotor core comprises a first annular ring and a plurality of first magnetic blocks protruding at intervals from an outer side of the first annular ring in a circumferential direction, and a first groove is formed between every two adjacent first magnetic blocks;
the second rotor core comprises a second annular ring and a plurality of second magnetic blocks protruding at intervals from an outer side of the second annular ring in a circumferential direction, and a second groove is formed between every two adjacent second magnetic blocks;
the first rotor core and the second rotor core are axially embedded with each other; the first magnetic blocks are embedded in second grooves, and the second magnetic blocks are embedded in first grooves;
each of the plurality of second magnetic blocks comprises two sides, and a first side groove and a second side groove are respectively formed between the two sides and two adjacent first magnetic blocks; an axial thickness H1 of the second magnetic blocks is smaller than an axial thickness H2 of the first magnetic blocks, so that a first top surface of the second magnetic blocks is lower than a second top surface of two adjacent first magnetic blocks, thereby forming a top groove on the second magnetic blocks; and
each of the plurality of magnetic tiles comprises a top tile, a first side tile and a second side tile, and the first side tile and the second side tile are respectively connected to two ends of the top tile; the top tile is embedded in the top groove, and the first side tile and the second side tile are respectively embedded in the first side groove and the second side groove, respectively.
2. The rotor of claim 1, wherein each of the first magnetic blocks is connected to the first annular ring through a first connecting rib; a thickness of the first annular ring is the same as that of the first connecting rib, and the axial thickness of the first magnetic blocks is greater than the thickness of the first annular ring.
3. The rotor of claim 2, wherein each of the second magnetic blocks is connected to the second annular ring through a second connecting rib; a thickness of the second annular ring is the same as that of the second connecting rib, and the axial thickness of the second magnetic blocks is greater than the thickness of the second annular ring.
4. The rotor of claim 3, wherein a cross-sectional shape of the magnetic tile is a “U” shape.
5. The rotor of claim 1, wherein the top tile is a fan-shaped plate.
6. The rotor of claim 5, wherein the first magnetic blocks and the second magnetic blocks are fan-shaped blocks.
7. The rotor of claim 1, wherein the first side tile and the second side tile are flat plates, and are radially aslant embedded into the first side groove and the second side groove, respectively, with an inclination angle α.
8. The rotor of claim 7, wherein the inclination angle α is in the range of 2.5°-7.5°.
9. The rotor of claim 3, wherein the first annular ring is integrated with the first connecting rib and located at a top end of the rotor; the second annular ring is integrated with the second connecting rib and located at a bottom end of the rotor; and the first annular ring is spaced apart from the second annular ring.
10. The rotor of claim 1, wherein the first side tile and the second side tile are perpendicular to the top tile or are inclined relative to the top tile.
11. The rotor of claim 1, wherein two sides of a top surface of each of the first magnetic blocks comprise a first flange, and two first flanges abut against the top tile to limit an axial movement of the magnetic tiles; an inner end and an outer end of each of the second magnetic blocks comprise a second flange, and the top tile is disposed between two second flanges, and thus a radial movement of the magnetic tiles is limited.
12. The rotor of claim 1, wherein magnetization directions of the magnetic tiles are consistent, from inside to outside or from outside to inside.
13. A disc permanent magnet motor comprising a stator assembly and a rotor assembly; wherein the stator assembly is axially magnetically coupled to the rotor assembly, and the rotor assembly comprises the rotor of claim 1....

Claims

What is claimed is:
1. A stator lamination, comprising:
a middle part;
an annular yoke; and
a plurality of stator teeth;
wherein:
the middle part comprises a central hole;
the plurality of stator teeth extend from an inner side of the annular yoke and are evenly distributed on the annular yoke;
a wire slot is formed between every two adjacent stator teeth, whereby a plurality of wire slots are formed on the annular yoke;
each of the plurality of stator teeth comprises a tooth root and a pole shoe disposed at one end of the tooth root;
the stator lamination has an outer diameter D1 ranging from 61.75 mm to 68.25 mm, and the central hole has a diameter D2 ranging from 31.6 mm to 35 mm;
the plurality of wire slots are evenly distributed around an edge of a circle, and a bottom part of each wire slot is tangent to the circle, and the circle has a diameter D3 ranging from 54.72 mm to 60.48 mm;
the tooth root has a tooth width L1 ranging from 4.75 mm to 5.25 mm, and the pole shoe has a thickness H1 ranging from 0.3 L1 to 0.45 L1; and
the stator lamination comprises eight stator teeth and eight wire slots.
2. The stator lamination of claim 1, wherein the tooth width L1 of the tooth root is 5 mm, and the thickness H1 of the pole shoe is in the range of 1.5 mm to 2.25 mm.
3. The stator lamination of claim 2, wherein the annular yoke has a minimum thickness H2 ranging from 3.5 mm to 3.9 mm.
4. The stator lamination of claim 3, wherein the outer diameter D1 of the stator lamination is 65 mm, the central hole has a diameter D2 of 33.3 mm, the diameter D3 of the circle is 57.6 mm, the thickness H1 of the pole shoe is 2.15 mm, and the minimum thickness H2 of the annular yoke is 3.7 mm.
5. The stator lamination of claim 4, wherein each of the plurality of wire slots comprises an arc segment and two straight segments respectively tangent to both ends of the arc segment, and each tooth root comprises a tooth edge perpendicular to the two straight segments.
6. The stator lamination of claim 1, wherein the annular yoke has a minimum thickness H2 ranging from 3.5 mm to 3.9 mm.
7. The stator lamination of claim 6, wherein the outer diameter D1 of the stator lamination is 65 mm, the central hole has a diameter D2 of 33.3 mm, the diameter D3 of the circle is 57.6 mm, the thickness H1 of the pole shoe is 2.15 mm, and the minimum thickness H2 of the annular yoke is 3.7 mm.
8. The stator lamination of claim 7, wherein each of the plurality of wire slots comprises an arc segment and two straight segments respectively tangent to both ends of the arc segment, and each tooth root comprises a tooth edge perpendicular to the two straight segments.
9. An electric motor, comprising:
a rotor assembly;
a stator assembly; and
a casing assembly;
wherein
the stator assembly is disposed inside the casing assembly; the rotor assembly is disposed within the stator assembly;
the stator assembly comprises a stator core, an end insulator, and a plurality of coil windings, and the stator core comprises a plurality of stator laminations stacked together;
the rotor assembly comprises a rotating shaft and a rotor core comprising a plurality of rotor laminations stacked together;
each of the plurality of rotor laminations comprises a shaft hole and a plurality of rotor slots; the rotating shaft is disposed through shaft holes, and the plurality of rotor slots are uniformly distributed around an edge of each of the plurality of rotor laminations; the electric motor further comprises a plurality of conductive elements respectively disposed inside the rotor slots; a rotor tooth is formed between every two adjacent rotor slots; and
each of the plurality of stator laminations comprises eight wire slots; and a ratio of a number of wire slots in each stator lamination to a number of rotor slots in each rotor lamination is in the range of 8:13 to 8:24.
10. The electric motor of claim 9, wherein the ratio of the number of wire slots in each stator lamination to the number of rotor slots in each rotor lamination is 8:15.
11. The electric motor of claim 10, wherein each of the plurality of rotor laminations has a diameter D4 ranging from 31.6 mm to 35 mm; the shaft hole has a diameter D5 ranging from 7.6 mm to 8.4 mm; and the rotor tooth has a width L2 ranging from 2.328 mm to 2.573 mm.
12. The electric motor of claim 11, wherein the diameter D4 of each of the plurality of rotor laminations is 33.3 mm; the diameter D5 of the shaft hole is 8 mm; and the width L2 of the rotor tooth is 2.45 mm....

Claims

What is claimed is:
1. A slew-rate control circuit, comprising:
a proportional calculation circuit, configured to parallelly receive a plurality of first signals within a current preset period, generate a first indicating voltage according to a plurality of adjusted first signals within a previous preset period and the plurality of first signals within the current preset period, and generate a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and a plurality of second signals that are inverted from the plurality of first signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between a number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and a number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
a logic operation circuit, coupled to the proportional calculation circuit, wherein the logic operation circuit is configured to receive the first indicating voltage and the second indicating voltage, and generate an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
an output adjustment circuit, coupled to the logic operation circuit, wherein the output adjustment circuit is configured to receive the operation result, and determine whether to invert the plurality of first signals within the current preset period to correspondingly generate a plurality of adjusted first signals within the current preset period according to the operation result.
2. The slew-rate control circuit of claim 1, wherein the first reference voltage is an upper limit of a preset slew rate range, and the second reference voltage is a lower limit of the preset slew rate range.
3. The slew-rate control circuit of claim 1, wherein the proportional calculation circuit comprises:
a first proportional calculation subcircuit, configured to parallelly receive the plurality of first signals within the current preset period, and generate the first indicating voltage according to the first numerical relationship; and
a second proportional calculation subcircuit, configured to parallelly receive the plurality of first signals within the current preset period, invert the plurality of first signals within the current preset period to obtain the plurality of second signals, and generate the second indicating voltage according to the second numerical relationship.
4. The slew-rate control circuit of claim 3, wherein the first proportional calculation subcircuit comprises a plurality of branches,
wherein the plurality of branches are coupled in parallel, and a voltage value of each first signal within the current preset period is input into a respective one of the plurality of branches,
wherein for each of the plurality of branches, after a transition from a corresponding adjusted first signal of a first level state within the previous preset period to a corresponding first signal of a second level state within the current preset period, this branch conducts when the first level state is different from the second level state, at which time the first indicating voltage is generated at a common end of the plurality of branches.
5. The slew-rate control circuit of claim 4, wherein each branch in the plurality of branches of the first proportional calculation subcircuit comprises a PMOS transistor, an NMOS transistor, and a resistor, wherein the PMOS transistor and the NMOS transistor are coupled in parallel, a first end of the parallel-coupled PMOS transistor and the NMOS transistor receives a voltage value of the corresponding first signal within the current preset period, and a second end of the parallel-coupled PMOS transistor and the NMOS transistor is coupled to the resistor, wherein the NMOS transistor and the PMOS transistor are turned on when the first level state is different from the second level state.
6. The slew-rate control circuit of claim 3, wherein the second proportional calculation subcircuit comprises a plurality of branches,
wherein the plurality of branches are coupled in parallel, and a voltage value of each second signal within the current preset period is input into a respective one of the plurality of branches,
wherein for each of the plurality of branches, after a transition from a corresponding adjusted first signal of a first level state within the previous preset period to a corresponding second signal of a third level state within the current preset period, this branch conducts when the first level state is different from the third level state, at which time the second indicating voltage is generated at a common end of the plurality of branches.
7. The slew-rate control circuit of claim 6, wherein each branch in the plurality of branches of the second proportional calculation subcircuit comprises a PMOS transistor, an NMOS transistor, and a resistor, wherein the PMOS transistor and the NMOS transistor are coupled in parallel, a first end of the parallel-coupled PMOS transistor and the NMOS transistor receives a voltage value of the corresponding second signal within the current preset period, and a second end of the parallel-coupled PMOS transistor and the NMOS transistor is coupled to the resistor, wherein the NMOS transistor and the PMOS transistor are turned on when the first level state is different from the third level state.
8. The slew-rate control circuit of claim 1, wherein the logic operation circuit comprises:
a first operation circuit, coupled to the proportional calculation circuit, configured to generate a first initial operation result according to the numerical relationship between the first indicating voltage, and the first and second reference voltages;
a second operation circuit, coupled to the proportional calculation circuit, configured to generate a second initial operation result according to the numerical relationship between the second indicating voltage, and the first and second reference voltages; and
a third operation circuit, coupled to the first operation circuit and the second operation circuit, configured to receive the first initial operation result and the second initial operation result, perform a logic operation on the first initial operation result and the second initial operation result, and generate the operation result that indicates whether to invert the plurality of first signals within the current preset period.
9. The slew-rate control circuit of claim 8, wherein
when the first indicating voltage is greater than the first reference voltage or less than the second reference voltage, the first initial operation result is in a first logic state; and
when the first indicating voltage is not greater than the first reference voltage and not less than the second reference voltage, the first initial operation result is in a second logic state, wherein the first logic state is different from the second logic state.
10. The slew-rate control circuit of claim 8, wherein
when the second indicating voltage is greater than the first reference voltage or less than the second reference voltage, the second initial operation result is in a third logic state; and
when the second indicating voltage is not greater than the first reference voltage and not less than the second reference voltage, the second initial operation result is in a fourth logic state, wherein the third logic state is different from the fourth logic state.
11. The slew-rate control circuit of claim 8, wherein the first operation circuit comprises:
a first comparator, wherein a non-inverting input end of the first comparator receives the first indicating voltage, an inverting input end of the first comparator receives the first reference voltage, and an output end of the first comparator outputs a first comparison result;
a second comparator, wherein a non-inverting input end of the second comparator receives the second reference voltage, an inverting input end of the second comparator receives the second indicating voltage, and an output end of the second comparator outputs a second comparison result; and
an XOR gate, wherein the XOR gate performs an XOR operation on the first comparison result and the second comparison result, and generates the first initial operation result.
12. The slew-rate control circuit of claim 8, wherein the second operation circuit comprises:
a third comparator, wherein a non-inverting input end of the third comparator receives the first reference voltage, an inverting input end of the third comparator receives the second indicating voltage, and an output end of the third comparator outputs a third comparison result;
a fourth comparator, wherein a non-inverting input end of the fourth comparator receives the second indicating voltage, an inverting input end of the fourth comparator receives the second reference voltage, and an output end of the fourth comparator outputs a fourth comparison result; and
a first AND gate, wherein the first AND gate performs an AND operation on the third comparison result and the fourth comparison result, and generates the second initial operation result.
13. The slew-rate control circuit of claim 8, wherein the third operation circuit comprises:
a second AND gate, coupled to the first operation circuit and the second operation circuit, configured to perform an AND operation on the first initial operation result and the second initial operation result, and generate the operation result.
14. The slew-rate control circuit of claim 8, wherein the operation result in a fifth logic state indicates that that the plurality of first signals within the current preset period are to be inverted; the operation result in a sixth logic state indicates that the plurality of first signals within the current preset period are not to be inverted, wherein the fifth logic state is different from the sixth logic state.
15. The slew-rate control circuit of claim 1, wherein the output adjustment circuit comprises:
a first PMOS transistor and a first NMOS transistor coupled in parallel; and
a second PMOS transistor, a third PMOS transistor, a second NMOS transistor, and a third NMOS transistor coupled in series;
wherein the operation result is input to a control end of the first PMOS transistor and a control end of the third NMOS transistor;
wherein the plurality of first signals are input to a control end of the third PMOS transistor, a control end of the second NMOS transistor, and a common node of the parallel-coupled first PMOS transistor and first NMOS transistor; and
wherein an inverted operation result is input to a control end of the first NMOS transistor and a control end of the second PMOS transistor.
16. A slew-rate control method, comprising:
obtaining, using a proportional calculation circuit, a plurality of first signals within a current preset period, a plurality of adjusted first signals within a previous preset period, and a plurality of second signals that are inverted from the plurality of first signals within the current preset period;
generating, using the proportional calculation circuit, a first indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of first signals within the current preset period, and generating a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of second signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between a number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and a number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
generating, using a logic operation circuit, an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
determining, using an output adjustment circuit, whether to invert the plurality of first signals within the current preset period to correspondingly generate a plurality of adjusted first signals within the current preset period according to the operation result.
17. The slew-rate control method of claim 16, wherein the proportional calculation circuit comprises a first proportional calculation subcircuit and a second proportional calculation subcircuit; wherein the slew-rate control method further comprises:
receiving, using the first proportional calculation subcircuit, the plurality of first signals within the current preset period, and generating the first indicating voltage according to the first numerical relationship; and
receiving, using the second proportional calculation subcircuit, the plurality of first signals within the current preset period, inverting the plurality of first signals within the current preset period to obtain the plurality of second signals, and generating the second indicating voltage according to the second numerical relationship.
18. The slew-rate control method of claim 16, wherein the logic operation circuit comprises a first operation circuit, a second operation circuit, and a third operation circuit, a step of generating the operation result comprises:
generating, using the first operation circuit, a first initial operation result according to the numerical relationship between the first indicating voltage, and the first and second reference voltages;
generating, using the second operation circuit, a second initial operation result according to the numerical relationship between the second indicating voltage, and the first and second reference voltages; and
performing, using the third operation circuit, a logic operation on the first initial operation result and the second initial operation result, and generating the operation result that indicates whether to invert the plurality of first signals within the current preset period.
19. A slew-rate control system, comprising:
a slew-rate control circuit, configured to parallelly receive a plurality of first signals within a current preset period, determine whether to invert the plurality of first signals within the current preset period to generate a plurality of adjusted first signals within the current preset period, according to a level relationship between a level state of each adjusted first signal in a previous preset period and a level state of a corresponding first signal in the current preset period, and a level relationship between a level state of each adjusted first signal in the previous preset period and a level state of a corresponding second signal in the current preset period, wherein a plurality of second signals are obtained by inverting the plurality of first signals within the current preset period; and
a signal output circuit, coupled to the slew-rate control circuit, configured to parallelly output the plurality of adjusted first signals within the current preset period.
20. The slew-rate control system of claim 19, wherein the slew-rate control circuit comprises:
a proportional calculation circuit, configured to parallelly receive the plurality of first signals within the current preset period, generate a first indicating voltage according to a plurality of adjusted first signals within the previous preset period and the plurality of first signals within the current preset period, and generate a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of second signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
a logic operation circuit, coupled to the proportional calculation circuit, configured to generate an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
an output adjustment circuit, coupled to the logic operation circuit, configured to receive the operation result, and determine whether to invert the plurality of first signals within the current preset period to correspondingly generate the plurality of adjusted first signals within the current preset period according to the operation result....

Claims

What is claimed is:
1. A method for promoting expression of a foreign gene in a plant, the method comprising: constructing a recombinant vector comprising a soybean gene promoter pEIF1 or an intron-comprising soybean gene promoter pEIF1-I, and introducing the recombinant vector into the plant; the promoter pEIF1 being represented by SEQ ID NO: 5, and the intron-comprising promoter pEIF1-I being represented by SEQ ID NO: 6.
2. The method of claim 1, wherein the foreign gene is beta-glucuronidase (GUS) gene.
3. The method of claim 1, wherein the plant is soybean, and the expression of the foreign gene occurs in cotyledons, radicles, plumules, true leaves, compound leaves, buds, petioles, internodes, roots and root nodules of the soybean.
4. The method of claim 1, wherein the plant is Arabidopsis, and the expression of the foreign gene occurs in whole plant, flower and pod of the Arabidopsis.
5. The method of claim 1, wherein the plant is tobacco, and the expression of the foreign gene occurs in leaves of the tobacco.
6. A method for preparing a recombinant vector comprising a soybean gene promoter, the method comprising inserting a soybean gene promoter pEIF1 or pEIF1-I into a vector pCAMBIA1391Z-BAR, wherein inserting the soybean gene promoter pEIF1 or pEIF1-I into the vector pCAMBIA1391Z-BAR comprises using a PCR amplification fragment of pEIF1 or pEIF1-I as a template, and cloning the PCR amplification fragment into a soybean stable transformation vector pCAMBIA1391Z-BAR by seamless cloning to obtain a soybean stable transformation vector pEIF1-GUS-BAR or pEIF1-I-GUS-BAR;
the vector pCAMBIA1391Z-BAR is obtained by linearizing a vector pCAMBIA1391Z with a restriction enzyme XhoI, and replacing a gene HygR with a gene BAR by seamless cloning;
the recombinant vector pEIF1-GUS-BAR is amplified using the following primers:
pEIF1-GUS-BAR-F:
(SEQ ID NO: 16)
GACCATGATTACGCCAAGCTTGGAGAGAAGTTGAACTCTGAGT
TGTG;
pEIF1-GUS-BAR-R:
(SEQ ID NO: 24)
CCAGTGAATTCCCGGGGATCCCTGATCGTAAATTTAAGGTTTCG;
the recombinant vector pEIF1-I-GUS-BAR is amplified using the following primers:
pEIF1-I-GUS-BAR-F:
(SEQ ID NO: 16)
GACCATGATTACGCCAAGCTTGGAGAGAAGTTGAACTCTGAGT
TGTG;
pEIF1-I-GUS-BAR-R:
(SEQ ID NO: 17)
CCAGTGAATTCCCGGGGATCCAAAACTTGACTCACTAAGACCA
AAGG;
the promoter pEIF1 has a nucleotide sequence of SEQ ID NO: 5, and the promoter pEIF1-I has a nucleotide sequence of SEQ ID NO: 6....

Claims

What is claimed is:
1. A three-axis Hall angle sensor, comprising: four horizontal Hall elements and eight vertical Hall elements disposed on a plane, wherein:
the eight vertical Hall elements are divided into two groups, an X-direction group and a Y-direction group, the X-direction group comprising four vertical Hall elements X1, X2, X3 and X4, and the Y-direction group comprising four vertical Hall elements Y1, Y2, Y3 and Y4; each vertical Hall element comprises four three-contact Hall components, and the four three-contact Hall components are connected end-to-end in series; the four horizontal Hall elements comprising Z1, Z2, Z3 and Z4 are in a 2×2 array arrangement; in the X-direction group, X1 and X2 are located on a left side of the four horizontal Hall elements; X2 is located between X1 and four horizontal Hall elements; X3 and X4 are located on a right side of the four horizontal Hall elements, and X3 is located between X4 and the four horizontal Hall elements;
X1 comprises the four three-contact Hall components, in which middle electrodes are AX1, BX1, CX1 and DX1 in sequence; X2 comprises the four three-contact Hall components, in which middle electrodes are AX2, BX2, CX2, and DX2 in sequence; X3 comprises the four three-contact Hall components, in which middle electrodes are AX3, BX3, CX3 and DX3 in sequence; X4 comprises the four three-contact Hall components, in which middle electrodes are AX4, BX4, CX4 and DX4 in sequence; when measuring an X-direction magnetic field, for a first vertical Hall element X1, applying a current bias between contact electrodes of BX1 and DX1, and measuring a Hall voltage VHallX1 between contact electrodes of AX1 and CX1; for a second vertical Hall element X2, applying a current bias between contact electrodes of BX2 and DX2, and simultaneously measuring a Hall voltage VHallX2 generated between AX2 and CX2; for a third vertical Hall element X3, applying a current bias between contact electrodes of CX3 and AX3, and measuring a Hall voltage VHallX3 between contact electrodes of BX3 and DX3; for a fourth vertical Hall element X4, applying a current bias between the AX4 and CX4 contact electrodes, and measuring a Hall voltage VHallX4 between contact electrodes of DX4 and BX4;
in a Y direction, vertical Hall elements Y1 and Y2 are located on an upper side of the four horizontal Hall elements, and Y2 is located between Y1 and the four horizontal Hall elements; vertical Hall elements Y3 and Y4 are located on a lower side of the four horizontal Hall elements, and Y3 is located between Y4 and the four horizontal Hall elements; Y1 comprises the four three-contact Hall components, in which middle electrodes are AY1, BY1, CY1 and DY1 in sequence; Y2 comprises the four three-contact Hall components, in which intermediate electrodes are AY2, BY2, CY2 and DY2 in sequence; Y3 comprise the four three-contact Hall components, in which intermediate electrodes are AY3, BY3, CY3 and DY3 in sequence; Y4 comprises the four three-contact Hall components, and intermediate electrodes are AY4, BY4, CY4 and DY4 in sequence;
when measuring a magnetic field in the Y direction, the following steps are taken: for a first vertical Hall element Y1, applying a current bias between DY1 and BY1, and measuring a Hall voltage VHallY1 between contact electrodes of AY1 and CY1; for a second vertical Hall element Y2, applying a current bias between BY2 and DY2, and simultaneously measuring a sensing Hall voltage VHallY2 generated between AY2 and CY2; for a third vertical Hall element Y3, applying a current bias between contact electrodes of AY3 and CY3, and measuring a Hall voltage VHallY3 between contact electrodes of DY3 and BY3; for a fourth vertical Hall element Y4, applying a current bias between the BY4 and DY4 contact electrodes, then measuring a Hall voltages VHallY4 between contact electrodes of CY4 and AY4;
each horizontal Hall element comprises four electrodes: A, B, C and D; a first horizontal Hall element Z1 is applied with a bias current between electrodes AZ1 and CZ1, and measuring a Hall voltage VHallZ1 generated between electrodes DZ1 and BZ1; for a second horizontal Hall element Z2, applying a current bias between electrodes BZ2 and DZ2, then measuring a Hall voltage VHallZ2 between electrodes AZ2 and CZ2; for a third horizontal Hall element Z3, applying a current bias between electrodes CZ3 and AZ3, then measuring a Hall voltage VHallZ3 between electrodes BZ3 and DZ3; for a fourth horizontal Hall element Z4, applying a current bias between electrodes DZ4 and BZ4, and measuring a Hall voltage VHallZ4 between electrodes CZ4 and AZ4; and the four identical Hall elements, Z1, Z2, Z3, Z4, are connected together by orthogonal coupling.
2. The three-axis Hall angle sensor of claim 1, wherein a current transmission equation of the three-axis Hall angle sensor Jn is:
J
n
=
J
n
⁢
0
·
M
(
1
)
M
=
1
1
+
a
2
+
b
2
+
c
2
⁢
(
1
+
a
2
ab
-
c
ca
+
b
c
+
ab
1
+
b
2
bc
-
a
ca
-
b
a
+
bc
1
+
c
2
)
(
2
)
a
=
μ
H
·
B
X
(
3
)
b
=
μ
H
·
B
Y
(
4
)
c
=
μ
H
·
B
Z
(
5
)
where Jn0 represents a zero magnetic field electron current density, μH=r·μ and represents a Hall mobility of electrons, r is a Hall coefficient, μ represents an electron mobility, and BX, BY, BZ respectively represent magnetic field components in X, Y and Z directions....

Claims

What is claimed is:
1. A method, comprising:
mixing starch and a first ethanol aqueous solution at a temperature of 90-150° C. to yield a mixture of a V-type granular starch and the first ethanol aqueous solution; and
adding a mixed enzyme comprising alpha-amylase and amyloglucosidase to the mixture of the V-type granular starch and the first ethanol aqueous solution, to enzymatically hydrolyze the V-type granular starch to yield a starch dispersion, wherein an addition amount of the mixed enzyme is 30,000-200,000 U per gram of the V-type granular starch; and vacuum-filtering the starch dispersion, washing for 2 to 3 times with a second ethanol aqueous solution with an ethanol concentration of 95% v/v, drying at 110° C. for 2 h, grinding, and sieving to yield V-type granular porous starch having a specific surface area of 9.99-39.94 m2/g and an average pore size of 26.61-27.61 nm.
2. The method of claim 1, wherein an ethanol concentration of the first ethanol aqueous solution is 50-80% v/v.
3. The method of claim 2, wherein a mass ratio of the starch to the first ethanol aqueous solution is between 1:2 and 1:5.
4. The method of claim 3, wherein the starch is selected from the group consisting of common corn starch, cassava starch, rice starch, barley starch, wheat starch, and potato starch.
5. The method of claim 4, wherein an enzyme activity ratio of the α-amylase to the amyloglucosidase in the mixed enzyme is between 1:2 and 1:5; and the V-type granular starch is enzymatically hydrolyzed at 20-60° C. for 6-12 h.
6. The method of claim 1, further comprising:
(1) adding the starch and the first ethanol aqueous solution to a reactor, to yield the mixture of the V-type granular starch and the first ethanol aqueous solution;
(2) cooling the mixture of the V-type granular starch and the first ethanol aqueous solution in the reactor to a temperature of 25-55° C., and adding the mixed enzyme to the reactor to enzymatically hydrolyze the V-type granular starch to yield the starch dispersion;
(3) carrying out suction filtration on the starch dispersion obtained in (2) by using a vacuum suction filtration device, washing a resulting product by using the second ethanol aqueous solution, drying the product in a first air-drying oven at 110° C. for 2 h, cooling, grinding and screening the product with an 80-mesh screen to obtain the V-type granular porous starch;
(4) dissolving a monoglyceride in het absolute ethanol, to yield a first solution;
(5) adding the V-type granular porous starch prepared in (3) into ethanol, to yield a second solution; and
(6) mixing the first solution and the second solution, carrying out suction filtration on a mixture of the first solution and the second solution, washing a resulting mixture by using the second ethanol aqueous solution, drying the mixture in a second air-drying oven, cooling, and grinding the mixture.
7. The method of claim 6, wherein in (1), the reactor operates at a rotating speed of 500 r/min for 0.5 hour; an ethanol concentration of the first ethanol aqueous solution is 50-90% v/v; a concentration of the starch is 10-40% v/v; and when a temperature in the reactor decreases to 60° C., a reaction between the starch and the first ethanol aqueous solution stops.
8. The method of claim 6, wherein in (2), the mixed enzyme is 4 mL of a mixed solution of α-amylase and amyloglucosidase with a ratio thereof 1:4; an enzymolysis time is 4-12 h; an enzymolysis temperature is 25-55° C.; and a rotating speed of a stirring blade in the reactor is 100-900 r/min.
9. The method of claim 6, wherein in (6), the first solution and the second solution are mixed at 25° C. for 2 hours at a rotating speed of 500 r/min; the resulting mixture is washed by the second ethanol aqueous solution having a concentration of 95% v/v for 2 to 3 times, dried at 50° C. for 12 h, ground and screened with an 80-mesh screen.
10. A V-type granular porous starch, prepared by the method of claim 1, having an oil adsorption rate of 276.33-528.58% by weight, and a water adsorption rate of 410.24-847.80% by weight....

Claims

What is claimed is:
1. A cutting tool for machining titanium alloy or superalloy, comprising a Me-B-N coating, wherein Me is one or more elements selected from the transition metals V, Nb, Ta, and Mo; the atomic percentages of each element are as follows: Me: 8-40% B: 15-60%, and N: 10-65%; and the Me—B—N coating comprises a MeNx phase and a BN phase.
2. The cutting tool of claim 1 wherein the Me-B-N coating has a thickness of 0.3-5 μm....

Claims

What is claimed is:
1. A method for predicting multi-type electrocardiogram (ECG) heart rhythms, the method comprising:
(1) acquiring 12-lead ECG signals from a body surface of a patient, and resampling an ECG signal of each lead to a same signal length;
(2) constructing a node mutual information pooling U-shaped graph convolution network, and extracting deep features of the ECG signals by using a feature extraction module in the graph convolution network;
(3) performing one-layer one-dimensional convolution on the deep features to obtain a graph feature matrix to be constructed, where rows of the graph feature matrix correspond to various types of arrhythmias to be predicted, and columns of the graph feature matrix correspond to feature vectors corresponding to the various types of arrhythmias; and, converting the graph feature matrix into an undirected graph G(V, A, E, W, X), where V is a point set of the undirected graph, and each node in the point set corresponds to each type of arrhythmias; E is an edge set of the undirected graph, which records a similarity between nodes; W is a weight matrix, which gives different weights to different edges; X is a node feature matrix; and, A is a node adjacency matrix;
(4) inputting the obtained undirected graph into a graph encoding module in the graph convolution network, quantitatively calculating node mutual information of the undirected graph by using the graph encoding module, and selecting a node subset with maximum mutual information to decrease a number of nodes in the undirected graph for down-sampling;
(5) inputting the undirected graph with decreased number of nodes into a graph decoding module in the graph convolution network, up-sampling, by using the graph decoding module, the undirected graph according to existing node indexes to restore an original number of nodes so as to generate a new graph feature matrix, and adding the new graph feature matrix with the graph feature matrix before down-sampling and outputting an aggregate graph feature matrix;
(6) performing summation, maximization, minimization and averaging on the aggregate graph feature matrix, splicing a result obtained after four operations into a feature vector and inputting the feature vector into a fully-connected layer, and finally mapping to obtain a probability value of each type of arrhythmias; and
(7) training the graph convolution network through a cross entropy loss function by using a large amount of ECG data and labels of various arrhythmias to predict multi-type ECG heart rhythms.
2. The method of claim 1, wherein the feature extraction module comprises a one-dimensional convolution layer, a residual network ResNet34, and an average pooling layer which are successively connected to one another, and all convolution layers in the residual network ResNet34 are replaced by one-dimensional convolution.
3. The method of claim 1, wherein the graph encoding module selects the node subset with the maximum mutual information by using the following formula:
max
Ω
⊂
V
C
⁡
(
Ω
)
;
C
⁡
(
Ω
)
=
1
K
⁢
∑
v
∈
Ω
log
⁢
σ
⁡
(
T
w
(
x
v
,
y
𝒩
v
)
)
+
1
K
2
⁢
∑
v
,
u
∈
Ω
log
⁡
(
1
-
σ
⁡
(
T
w
(
x
v
,
y
𝒩
u
)
)
)
;
T
w
(
x
v
,
y
𝒩
v
)
=
𝒮
w
(
ℰ
w
(
x
v
)
,
𝒫
w
(
y
𝒩
v
)
)
;
T
w
(
x
v
,
y
𝒩
u
)
=
𝒮
w
(
ℰ
w
(
x
v
)
,
𝒫
w
(
y
𝒩
u
)
)
;
where Ω denotes the node subset; K is the number of nodes in the node subset Ω; V is the point set of the undirected graph; C(Ω) is a mutual information quantization function between neighboring nodes in the node subset Ω; v is any node in the node subset Ω; xv denotes the feature vector of the node v; σ( ) is a sigmoid activation function; v denotes all neighboring nodes of the node v; yNv is a feature matrix comprising the feature vectors of all neighboring nodes of the node v; w( ) is a vertex embedding function; w( ) is a neighborhood embedding function; Sw( ) is a vertex-neighborhood affinity function, which has the same function as w( ) and aggregates the result of w(xv); w( ) and w( ) are implemented by a multi-layer perceptron; and, w( ) is implemented by R-hop graph convolution.
4. The method of claim 1, wherein after up-sampling or down-sampling the undirected graph, the corresponding graph feature matrix is subjected to one-layer graph convolution to update features of all nodes in the undirected graph.
5. The method of claim 1, wherein in the process of training the graph convolution network in (7), parameters in the network are iteratively updated by an Adam algorithm until the cross entropy loss function is converged.
6. The method of claim 1, wherein the cross entropy loss function is expressed as follows:
L
=
{
l
1
,
…
,
l
N
}
⊤
;
l
n
=
-
w
n
[
y
n
·
log
⁢
x
n
+
(
1
-
y
n
)
·
log
⁡
(
1
-
x
n
)
]
;
w
n
=
1
log
⁡
(
Sum
(
lable
n
)
)
;
where L is the cross entropy loss function; ln is a loss function value of a nth type of arrhythmias; N is a number of arrhythmia disease types, n is a natural number and 1≤n≤N; wn is correspondingly a weight value of the nth type of arrhythmias; xn is a predicted probability value of the nth type of arrhythmias correspondingly output by inputting the current ECG signal into the graph convolution network; yn is a label value of the nth type of arrhythmias corresponding to the current ECG signal; and, Sum(lablen) is a number of training data labels about the nth type of arrhythmias.
7. The method of claim 1, wherein in (4), node mutual information pooling is a core of the graph encoding module; a graph pooling part is associated with node selection and new graph structure generation; a mutual information score between a node and a neighboring node is calculated in the graph pooling part, and top K node indexes with the highest score are returned.
8. The method of claim 1, wherein in (5), previously recorded node indexes are required during up-sampling, and a new graph feature matrix X′=O∈{0}N×d is generated; N is a number of arrhythmia disease types, and d is a dimension of feature; the graph feature matrix to be up-sampled is added with a down-sampled graph feature matrix in the same layer to obtain an up-sampled graph feature matrix....

Claims

CLAIM
1. The ornamental design for a brush head for an electric toothbrush as shown and described....

Claims

What is claimed is:
1. A device, comprising:
a power unit; and
a plurality of adjustment units;
wherein:
the plurality of adjustment units is disposed around a suspension cable to be replaced; the power unit is configured to power the plurality of adjustment units;
each of the plurality of adjustment units comprises a support frame, a connector, and a steel strand;
the power unit comprises two jacks, each jack comprising a main body;
the support frame is door-shaped and comprises two support columns, a top part, and a bottom part; the top part comprises a first through hole, and a nut fixed on an anchor is disposed in the first through hole; a hanger rod is disposed through the anchor and the nut, and fixed in the nut;
the bottom part comprises a second through hole, and the steel strand is disposed through the second through hole;
the connector is disposed in a central cavity of the support frame; one end of the connector is screwed to a first end of the hanger rod, and a second end of the connector is fixedly connected to one end of the steel strand; another end of the steel strand is fixedly connected to the main body of each jack; and
the bottom part of the support frame abuts against a top surface of each jack; and the top part of the support frame abuts against a bottom surface of the anchor.
2. The device of claim 1, wherein each of the two jacks is a hydraulic jack; the power unit further comprises a hydraulic hose and a post-tension stressed oil pump; each hydraulic jack comprises an oil inlet and the post-tension stressed oil pump comprises an oil outlet; and the oil outlet is connected to the oil inlet through the hydraulic hose.
3. The device of claim 2, wherein the power unit further comprises a three-way hydraulic connector disposed between the post-tension stressed oil pump and the two hydraulic jacks.
4. The device of claim 1, wherein the device comprises two adjustment units disposed symmetrically about the suspension cable.
5. The device of claim 4, wherein the connector is an anchorage connector.
6. The device of claim 5, wherein each of the two jacks is a core-through hydraulic jack; and the steel strand passes through each core-through hydraulic jack.
7. The device of claim 6, wherein the second through hole is disposed in a center of the bottom part of the support frame and is aligned with the core-through hydraulic jack....

Claims

What is claimed is:
1. An auxiliary support device for a rolling-cut shear, comprising:
a lower cutting table;
a plurality of first hydraulic support cylinders;
a plurality of support plates;
a plurality of second hydraulic support cylinders shorter than the plurality of first hydraulic support cylinders;
a slide plate; and
a plurality of horizontal hydraulic cylinders;
wherein
the lower cutting table comprises a first front end comprising a first mounting groove for receiving a lower shear blade of the rolling-cut shear, a second mounting groove, and an inner plate;
a bottom wall of the second mounting groove comprises a plurality of first bolt holes and a plurality of first recesses;
the inner plate is embedded in the second mounting groove through a plurality of bolts passing through the plurality of first bolt holes;
the inner plate comprises a plurality of second bolt holes and a plurality of second recesses; and the plurality of support plates lean against the inner plate;
the plurality of first hydraulic support cylinders and the plurality of horizontal hydraulic cylinders are disposed in the plurality of first recesses; each of the plurality of first hydraulic support cylinders comprises a first support rod; the slide plate comprises a first transverse plate, a second transverse plate, a third transverse plate, and a fourth transverse plate; a top end of the first support rod abuts against a bottom end of the fourth transverse plate; a second front end of each of the plurality of first hydraulic support cylinders is connected to a first rear end of each of the plurality of second hydraulic support cylinders through a connection rod; each of the plurality of second hydraulic support cylinders comprises a second support rod; and bottom ends of the first transverse plate, the second transverse plate, and the third transverse plate abut against top ends of second support rods, respectively; and
each of the plurality of horizontal hydraulic cylinders comprises a third support rod, and a second rear end of each of the plurality of first hydraulic support cylinders is connected to a third front end of the third support rod.
2. The device of claim 1, wherein the plurality of first hydraulic support cylinders synchronously control corresponding first support rods to extend and retract; the plurality of second hydraulic support cylinders synchronously control corresponding second support rods to extend and retract; the first support rods and the second support rods synchronously extend and retract with a speed; the plurality of horizontal hydraulic cylinders synchronously control corresponding third support rods to extend and retract; all hydraulic support cylinders are a hydraulic servosystem, and each of the hydraulic support cylinders is equipped with a built-in magnetostrictive displacement sensor to provide real-time feedback on a position of a corresponding support rod.
3. The device of claim 2, wherein a first bottom surface of each of the plurality of first hydraulic support cylinders and each of the plurality of second hydraulic support cylinders comprises a sliding groove configured to fit with a slide rail fixed on ground of a workshop; a top surface of the slide rail is flush with a second bottom surface of the lower cutting table; and a leading end of the slide rail is oriented to the same direction as a leading end of the lower cutting table.
4. The device of claim 3, wherein second rear ends of the plurality of first hydraulic support cylinders are embedded in the plurality of second recesses and the plurality of first recesses; the plurality of second recesses and the plurality of first recesses are in line with slide rails; two sides of the plurality of horizontal hydraulic cylinders are disposed in the plurality of first recesses; a third bottom surface of each of the plurality of horizontal hydraulic cylinders is flush with second bottom surface of the lower cutting table; and a third rear end of each of the plurality of horizontal hydraulic cylinders is disposed in the plurality of first recesses.
5. The device of claim 1, wherein the inner plate is attached to the bottom wall of the second mounting groove, and a longitudinal width of the inner plate is less than a longitudinal width of the second mounting groove; a width difference between the inner plate and the second mounting groove is equal to a thickness of the fourth transverse plate plus a mounting margin; the fourth transverse plate is parallel to the lower cutting table and is disposed in a gap between the inner plate and the second mounting groove; and a depth of the second mounting groove is equal to a width of the fourth transverse plate.
6. The device of claim 1, wherein bottom ends of the plurality of support plates are flush with a bottom end of the inner plate, and each of the bottom ends of the plurality of support plates comprises a right-angle groove for fitting and approaching the plurality of support plates to the second mounting groove of the lower cutting table; top ends of the plurality of support plates are flush with a top end of the inner plate, and the plurality of support plates abut at intervals against an outer wall of the inner plate....

Claims

What is claimed is:
1. An outer rotor of a motor, the outer rotor comprising: an annular rotor core and a plurality of permanent magnets; wherein the annular rotor core comprises a central hole; the annular rotor core further comprises a plurality of slots, and the plurality of permanent magnets are disposed in the plurality of slots and form a plurality of magnetic poles along a circumferential direction of the rotor core;
each magnetic pole comprises three shapes of permanent magnet: a first arc-shaped permanent magnet concentric with the rotor core and having a uniform thickness, a second arc-shaped permanent magnet not concentric with the rotor core, and a rectangular permanent magnet;
in each magnetic pole, the three shapes of permanent magnet are symmetrically arranged along a center line L of the magnetic pole, and the first arc-shaped permanent magnet, the second arc-shaped permanent magnet and the rectangular permanent magnet are sequentially spaced radially from inside to outside;
an inner arc-shaped surface of the first arc-shaped permanent magnet and an inner circular sidewall of the rotor core are of equal radius and form a flush structure;
one magnetic pole comprises at least three first arc-shaped permanent magnets, one second arc-shaped permanent magnet, and two rectangular permanent magnets; the at least three first arc-shaped permanent magnets are arranged at intervals along the circumferential direction of the rotor core, and a magnetic channel is formed between every two adjacent first arc-shaped permanent magnets;
the second arc-shaped permanent magnet is located between the at least three first arc-shaped permanent magnets and the rectangular permanent magnet, and the second arc-shaped permanent magnet is not in contact with the inner circular sidewall and outer circular sidewall of the rotor core; and an inner arc surface of the second arc-shaped permanent magnet covers at least one first arc-shaped permanent magnet and at least two magnetic channels.
2. The outer rotor of claim 1, wherein each magnetic pole has a central angle α3, α3=360°/2P, where P is a number of pairs of the magnetic poles on the rotor core; 1.5*α3>α1>0.5*α3, and 1.5*α3<α2<3*α3, where α1 is an included angle between the center line L of the magnetic pole and the rectangular permanent magnet, and α2 is a central angle of the second arc-shaped permanent magnet.
3. The outer rotor of claim 2, wherein the included angle α1 between the center line L of the magnetic pole and the rectangular permanent magnet is less than 90°, and the central angle α2 of the second arc-shaped permanent magnet is 45°<α2<180°.
4. The outer rotor of claim 3, wherein the first arc-shaped permanent magnets are three or four in number.
5. The outer rotor of claim 4, wherein the first arc-shaped permanent magnets have a thickness d, and the rotor core has a thickness D, where 0.16*D6. The outer rotor of claim 5, wherein a minimum distance between the second arc-shaped permanent magnet and the outer circular sidewall of the rotor core is L2, and 0.15*D7. The outer rotor of claim 6, wherein a minimum distance between the rectangular permanent magnet and the second arc-shaped permanent magnet is L3, and 0.15*D8. The outer rotor of claim 7, wherein the rotor core further comprises first auxiliary slots on both ends of the rectangular permanent magnet; a first narrow magnetic bridge is formed between one first auxiliary slot and the outer circular sidewall to reduce magnetic leakage; the rotor core further comprises second auxiliary slots on both ends of the second arc-shaped permanent magnet; a second narrow magnetic bridge is formed between one second auxiliary slot and an outer arc surface of the first arc-shaped permanent magnets to reduce magnetic leakage; and both the first auxiliary slots and the second auxiliary slots are filled with non-magnetic permeable materials.
9. The outer rotor of claim 8, wherein the second arc-shaped permanent magnet has a uniform thickness or is thick in the middle and thin at both ends.
10. The outer rotor of claim 8, wherein the first arc-shaped permanent magnet, the second arc-shaped permanent magnet, and the rectangular permanent magnet all comprise ferrite material; or, the first arc-shaped permanent magnet comprises neodymium iron boron material, and the second arc-shaped permanent magnet and the rectangular permanent magnet both comprise ferrite material.
11. A permanent magnet synchronous motor, comprising a stator assembly and the outer rotor of claim 1....

Claims

What is claimed is:
1. A method, comprising:
(1) collecting a plurality of activated sludge samples, acquiring raw data of images of the plurality of activated sludge samples, cleaning the raw data of the images, and standardizing data sizes of the images;
(2) calculating a sludge volume index (SVI) for each of the plurality of activated sludge samples;
(3) establishing, by using a ResNet50 deep neural network, a model for predicting the settleability of activated sludge; and
(4) predicting the settleability of a target activated sludge using the model established in (3);
wherein, (3) is implemented as follows:
(301) separating, by using the sludge volume index for each of the plurality of activated sludge samples obtained in (2), the plurality of activated sludge samples into a bulking sample set and a non-bulking sample set;
(302) augmenting the bulking sample set or the non-bulking sample set, to equalize the sample sizes between the bulking sample set and the non-bulking sample set;
(303) dividing a dataset for establishing the model into a training set, a validation set, and a testing set, and optimizing hyperparameters of the model;
(304) selecting optimal hyperparameters of the model, training the model to predict the settleability of activated sludge, and assessing a classification performance of the model using the testing set.
2. The method of claim 1, wherein in (1), the raw data of the images of the plurality of activated sludge samples are acquired using a high-throughput image acquisition system, and the raw data of the images is cleaned by removing blurry images and erroneous samples.
3. The method of claim 1, wherein in (2), for each of the plurality of activated sludge samples, the sludge volume index (SVI) is calculated using experimentally determined settled sludge volume (SV) and mixed liquor suspended solids (MILSS) concentration, following a calculation formula:
SVI
⁡
(
mL
·
g
-
1
)
=
S
⁢
V
⁡
(
mL
·
L
-
1
)
MLSS
⁡
(
g
·
L
-
1
)
.
4. The method of claim 1, wherein in (301), a threshold for SVI is defined; when the SVI of the activated sludge falls below the SVI threshold, the activated sludge sample is classified as bulking; otherwise, the activated sludge sample is classified as non-bulking; and the SVI threshold is set within the range of 150 to 190 mL·g−1.
5. The method of claim 1, wherein in (302), the augmenting comprises separately rotating the images by 90°, 180°, and 270° for the bulking sample set or the non-bulking sample set.
6. The method of claim 1, wherein in (303), the dataset is split into the training set and the testing set in proportion; during model training process, the training set is further automatically split into an operational training set and a validation set.
7. The method of claim 1, wherein in (303), the hyperparameters of the model are optimized; the hyperparameters comprise an optimizer and a learning rate; the optimizer is stochastic gradient descent; and the learning rate is optimized using a ReduceLROnPlateau callback function, thereby improving a speed of network convergence during training.
8. The method of claim 1, wherein in (304), while training the model to predict the settleability of activated sludge, a loss is calculated using a cross-entropy loss function.
9. The method of claim 1, wherein in (304), when assessing the classification performance of the model using the testing set, four metrics—Accuracy, Precision, Recall, and F1 score are used to measure and analyze classification capabilities of the model; the formula for calculating Accuracy is as follows:
Accuracy
⁢
=
T
⁢
P
+
T
⁢
N
T
⁢
P
+
F
⁢
P
+
T
⁢
N
+
F
⁢
N
;
the formula for calculating Precision is as follows:
Precision
⁢
=
T
⁢
P
T
⁢
P
+
F
⁢
P
the formula for calculating Recall is as follows:
Recall
=
T
⁢
P
T
⁢
P
+
F
⁢
N
the formula for calculating F1 score is as follows:
F
⁢
1
⁢
Score
=
2
×
precision
×
recall
precision
+
recall
;
where TP represents true positives, indicating instances where actual positive samples are correctly predicted as positive; TN represents true negatives, indicating instances where actual negative samples are correctly predicted as negative; FP represents false positives, indicating instances where actual negative samples are incorrectly predicted as positive; FN represents false negatives, indicating instances where actual positive samples are incorrectly predicted as negative.
10. The method of claim 1, wherein (4) is implemented as follows:
(401) collecting a plurality of activated sludge samples to be tested; and acquiring, by using a high-throughput image acquisition system, image data of the plurality of activated sludge sample to be tested;
(402) automatically standardizing the data sizes of the images for the plurality of activated sludge sample to be tested; and
(403) inputting standardized image data of the plurality of activated sludge samples to be tested into the model, generating operational output results, and thereby determining whether the tested activated sludge samples have undergone bulking....

Claims

What is claimed is:
1. A crystalline form B of a 2-(2,4,5-substituted phenylamino) pyrimidine derivative of formula I:
wherein a CuKα-X-ray powder diffraction (XRPD) spectrum of the crystalline form B comprises diffraction peaks at diffraction angle 2θ positions of 8.55°±0.2°, 9.47°±0.2°, 10.31°±0.2°, 12.65°±0.2°, 14.47°±0.2°, 15.17°±0.2°, 15.61°±0.2°, 16.29°±0.2°, 17.07°±0.2°, 17.31°±0.2°, 17.73°±0.2°, 18.22°±0.2°, 18.74°±0.2°, 19.47°±0.2°, 19.70°±0.2°, 20.24°±0.2°, 20.72°±0.2°, 21.68°±0.2°, 22.08°±0.2°, 22.80°±0.2°, 23.50°±0.2°, 23.99°±0.2°, 24.20°±0.2°, 24.83±0.2°, 25.65°±0.2°, 26.15±0.2°, 26.99°±0.2°, 27.69°±0.2°, 28.30°±0.2°, 29.57°±0.2°, 30.74°±0.2°, and 32.58°±0.2°.
2. A method of treatment of non-small cell lung cancer, the method comprising administering to a patient in need thereof an effective amount of the crystalline form B of the 2-(2,4,5-substituted phenylamino) pyrimidine derivative of claim 1.
3. The method of claim 2, wherein the method further comprises administering to the patient another lung cancer therapeutic drug....

Claims

What is claimed is:
1. A device, comprising:
a housing;
a plurality of supporting rods;
a roof plate;
a mixing room;
a lifting mechanism;
a stirring mechanism;
a control mechanism comprising a first conductive block and a second conductive block;
a driving mechanism; and
a cleaning mechanism;
wherein:
the housing comprises a top end and one end of each of the plurality of supporting rods is disposed on the top end, and the roof plate is disposed on the other end of each of the plurality of supporting rods;
the stirring mechanism is fixed on the roof plate;
the mixing room comprises a bottom wall and the housing comprises an inner bottom surface; the mixing room comprises a discharge port disposed on the bottom wall, and a seal plug disposed in the discharge port;
the lifting mechanism is disposed between the bottom wall and the inner bottom surface and an outer sidewall of the mixing room abuts against an inner sidewall of the housing;
the cleaning mechanism is disposed over the stirring mechanism;
the stirring mechanism comprises a stirring part and a rotating rod; the stirring part extends into the mixing room and the rotating rod is configured to move the first conductive block to abut against the second conductive block; and
the control mechanism is electrically connected to the stirring mechanism and the driving mechanism.
2. The device of claim 1, wherein the stirring mechanism comprises a rotating shaft, a plurality of stirring rods, and a driving member; the rotating shaft is flexibly connected through a first bearing to the roof plate; the rotating shaft is connected to the driving member via a transmission; and the plurality of stirring rods is disposed on two sides of the rotating shaft.
3. The device of claim 2, wherein the driving member comprises a motor, a driving wheel, and a driven wheel; the motor is fixed on the roof plate; an output terminal of the motor is connected to the driving wheel; the driven wheel is connected to the rotating shaft; and the driving wheel is engaged with the driven wheel.
4. The device of claim 2, wherein the cleaning mechanism comprises a U-shaped rod, four cleaning members, and a plurality of fixing rods; the driving mechanism comprises a movable end and the U-shaped rod is fixedly connected to the movable end; the U-shaped rod comprises a bottom end and the plurality of fixing rods are fixedly connected to the bottom end; and the four cleaning members are fixedly connected to the plurality of fixing rods and are divided into two groups opposite to each other to clean the plurality of stirring rods on two sides of the rotating shaft, respectively.
5. The device of claim 4, wherein the driving mechanism comprises a frame, a drive motor, a leadscrew, and a threaded sleeve; the frame comprises a lower portion and the drive motor is disposed on the lower portion; an output of the drive motor is connected to the leadscrew; the leadscrew comprises a distal end away from the drive motor and the distal end is connected through a second bearing to an upper portion of the frame; and the threaded sleeve is disposed around the leadscrew and is connected to the U-shaped rod via a connection rod.
6. The device of claim 1, wherein the lifting mechanism comprises a first controller and a telescopic cylinder; the first controller comprises a switch button and is electrically connected to the telescopic cylinder; and an output end of the telescopic cylinder is fixedly connected to the bottom wall of the mixing room.
7. The device of claim 1, wherein the control mechanism further comprises a controller and a power supply; the first conductive block is movable and is connected to the rotating rod; the second conductive block is immovable and abuts adapted to be abut against the first conductive block; the first conductive block and the power supply are electrically connected to the controller; and the second conductive block is electrically connected to the power supply.
8. The device of claim 7, wherein when the first conductive block abuts against the second conductive block, the controller is powered on by the power supply....

Claims

The invention claimed is:
1. A punching bag, comprising:
a main body module; and
a plurality of digital display modules;
wherein:
the main body module is a modularized body for boxing training, and comprises a cylinder body, a pillar, and a flange;
the cylinder body comprises a first member and a second member;
the first member comprises an upper part and a lower part integrated with the upper part; the upper part is cylindrical and the lower part is semicylindrical; the upper part comprises a central axial hole; the lower part comprises a first rectangular surface and a first axial semicircular groove disposed in a middle of the first rectangular surface; the first axial semicircular groove extends to communicate with the central axial hole of the upper part; diameters of the first axial semicircular groove and the central axial hole correspond to a diameter of the pillar;
the second member is semicylindrical, and comprises a second rectangular surface and a second axial semicircular groove disposed in a middle of the second rectangular surface; a diameter of the second axial semicircular groove corresponds to the diameter of the pillar;
the first member is in embedded connection to the second member to form the cylinder body; the first axial semicircular groove cooperates with the second axial semicircular groove to form an axial hole to receive the pillar;
the cylinder body is supported by the flange and locked by the pillar;
the main body module further comprises a buffer layer and an outer layer; the buffer layer is disposed between the cylinder body and the outer layer; a counterweight base is fixed on one end of the pillar; the buffer layer comprises a plurality of grooves, and the plurality of digital display modules are embedded in the plurality of grooves, respectively; and
each of the plurality of digital display modules comprise a touchscreen cover, a chip, a base plate, a light-emitting diode, and a pressure sensor; the chip comprises a front side and a back side, and the light-emitting diode is disposed on the front side and the pressure sensor is disposed on the back side; the touchscreen cover comprises a curved outer surface and translucent resilience material; the touchscreen cover further comprises a thickened center part comprising a plurality of dents; the touchscreen cover is attached to the base plate through an adhesive; the chip is connected to the digital control panel through a lead wire; an adapter sleeve is disposed on a back side of the digital control panel and sleeves the pillar.
2. The punching bag of claim 1, wherein the pressure sensor is a three-contact structure; a joint of the chip and the touchscreen cover and four contact corners of the chip and the base plate are provided with locating holes and locating pins; and a reinforcing rib is disposed on a back side of the base plate.
3. The punching bag of claim 1, wherein the cylinder body is a molded resilient structure or a container structure comprising a filler; the container structure is blow molded; the first member comprises a first top end comprising a first filling opening; and the second member comprises a second top end comprising a second filling opening.
4. The punching bag of claim 1, wherein an embedded part is disposed on an outer surface of a joint of the first member and the second member; the embedded part is a concave platform comprising connecting holes; and screws pass through the connecting holes to fixedly connect the first member and the second member.
5. The punching bag of claim 3, wherein a recess is disposed on a bottom of the upper part of the first member, and the second filling opening of the second member is located in the recess; and a vertical height ratio of the first member to the second member is 2:1.
6. The punching bag of claim 1, wherein a fixed bar and a non-skid tape are disposed on the pillar; the fixed bar is disposed at a lower part of a top end of the pillar, and the top end of the pillar is embedded in the central axial hole; and two ends of the fixed bar are disposed on a top side of the first rectangular surface of the first member....

Claims

What is claimed is:
1. An aryl sulfide of formula I, or an agriculturally acceptable salt thereof,
wherein:
n is 0 or 1;
X is fluorine, chlorine, or methyl;
Y is chlorine or methyl;
R1 is hydrogen, fluorine, chlorine, bromine, hydroxyl, nitro, hydroxymethyl, a cyano group, trifluoromethyl, C1-3 alkyl, C1-4 alkoxycarbonyl, acetyl, propionyl, C1-3 alkoxy, ethylthio, 2-fluoroethanothioxy, 2-chloroethanothioxy, 2,2-difluoroethylthio, 2,2,2-trifluoroethylthio, propylthio, 2,2,2-trifluoroethylsulfinyl, vinyloxycarbonyl, 2,2,2-trifluoroethoxycarbonyl, or n-methylcarbonyl;
R2 is hydrogen, fluorine, or chlorine;
R3 is hydrogen, fluorine, chlorine, bromine, or a cyano group;
R4 and R5 at each occurrence represent hydrogen; and
R6 is n-propyl or 2,2,2-trifluoroethyl.
2. The aryl sulfide of claim 1, wherein
n is 0 or 1;
X is fluorine;
Y is chlorine or methyl;
R1 is methoxycarbonyl, ethoxycarbonyl, ethylthio, or 2,2,2-trifluoroethylthio;
R2, R4, and R5 at each occurrence represent hydrogen;
R3 is hydrogen, fluorine, chlorine, or a cyano group; and
R6 is 2,2,2-trifluoroethyl.
3. The aryl sulfide of claim 1, wherein the aryl sulfide is:...

Claims

What is claimed is:
1. A rolling mechanism for grain refinement of a metal rod, comprising two main rolls and two auxiliary rolls; wherein:
the two main rolls are opposite to each other and the two auxiliary rolls are opposite to each other, and the two main rolls and the two auxiliary rolls are disposed around a rolling line to form a nip zone where a billet is rolled into the metal rod;
in any cross section of the nip zone with the rolling line as a normal line, a first line connecting central axes of the two main rolls is perpendicular to a second line connecting central axes of the two auxiliary rolls;
each main roll comprises a first protrusion portion, a first end portion and a second end portion; the first end portion and the second end portion are disposed opposite each other along a corresponding roll axis; the first end portion has a smaller diameter than the second end portion; the first protrusion portion is disposed between the first end portion and the second end portion;
each auxiliary roll comprises a second protrusion portion, a third end portion and a fourth end portion; the third end portion and the fourth end portion are disposed opposite each other along a corresponding roll axis; the third end portion has a smaller diameter than the fourth end portion; the second protrusion portion is disposed between the third end portion and the fourth end portion; and
the first protrusion portion has a greater diameter than the second protrusion portion; a narrow space of the nip zone is surrounded by the two first protrusion portions of the two main rolls and the two second protrusion portions of the two auxiliary rolls; the first end portion is disposed adjacent to the fourth end portion; and the second end portion is disposed adjacent to the third end portion.
2. The rolling mechanism of claim 1, wherein
a ratio of a length of the first line to a length of the second line is a constant ranging from 1-1.1; and/or
the two main rolls and the two auxiliary rolls have the same length; the first protrusion portion is disposed on a midpoint of a first axis from the first end portion to the second end portion; and the second protrusion portion is disposed on a midpoint of a second axis from the third end portion to the fourth end portion.
3. The rolling mechanism of claim 1, wherein:
the two main rolls and the two auxiliary rolls separately comprise at least three truncated cones arranged along a corresponding roll axis; each truncated cone comprises a top surface and a base surface; every two adjacent truncated cones are connected by attaching the top surface to an adjacent base surface; the top surface has the same diameter as the adjacent base surface; and
at least two of the at least three truncated cones of each main roll are disposed between the first protrusion portion and the second end portion, and at least two of the at least three truncated cones of each auxiliary roll are disposed between the second protrusion portion and the fourth end portion.
4. The rolling mechanism of claim 3, wherein each truncated cone has a roll surface angle ranging from 2.5° to 5°.
5. The rolling mechanism of claim 3, wherein
the at least three truncated cones of each main roll comprise a first truncated cone and a second truncated cone arranged from the first end portion to the second end portion; the first protrusion portion is formed between the first truncated cone and the second truncated cone; and
the at least three truncated cones of each auxiliary roll comprise a third truncated cone and a fourth truncated cone arranged from the third end portion to the fourth end portion; the second protrusion portion is formed between the third truncated cone and the fourth truncated cone.
6. The rolling mechanism of claim 5, wherein
a ratio of a length of each main roll to a diameter of the first protrusion portion ranges from 3 to 7; and/or a ratio of a diameter of the first protrusion portion to a diameter of the second protrusion portion ranges from 1 to 2.
7. A method for rolling an ultra-fine-grained M50NiL rod by using the rolling mechanism of claim 1, the method comprising:
S1. preparing an M50NiL rod with a diameter ranging from 220 mm to 350 mm as a billet;
S2. heating the billet within a preset time at a preset temperature;
S3. feeding the billet into the rolling mechanism to obtain a semi-finished product; and
S4. cooling the semi-finished product to obtain the ultra-fine-grained M50NiL rod;
wherein
an entry angle of the rolling mechanism ranges from 10° to 13°; and a nip angle of the rolling mechanism ranges from 7° to 10°.
8. The method of claim 7, wherein S3 further comprises: S3-1: feeding the heated billet through a feed inlet adjacent to the two second end portions into the nip zone for rolling, and forcing the semi-finished product to move through a feed outlet adjacent to the two fourth end portions.
9. The method of claim 8, wherein
the two main rolls have the same shape as the two auxiliary rolls; the two main rolls and the two auxiliary rolls separately comprise at least three truncated cones arranged along a corresponding roll axis; at least two of the at least three truncated cones of each main roll are disposed between the first protrusion portion and the second end portion, and at least two of the at least three truncated cones of each auxiliary roll are disposed between the second protrusion portion and the fourth end portion; for each main roll, a first truncated cone and a second truncated cone among the at least three truncated cones of the main roll are arranged from the first end portion to the second end portion; the first protrusion portion is formed between the first truncated cone and the second truncated cone; for each auxiliary roll, a third truncated cone and a fourth truncated cone among the at least three truncated cones of the auxiliary roll are arranged from the third end portion to the fourth end portion; the second protrusion portion is formed between the third truncated cone and the fourth truncated cone; distances between the two main rolls and between the two auxiliary rolls are adjustable; and S3 further comprises:
S3-2. adjusting the distances between the two main rolls and between the two auxiliary rolls; either feeding the heated billet through the feed inlet adjacent to the two second end portions into the nip zone for rolling and forcing the semi-finished product to move through the feed outlet adjacent to the two fourth end portions, or feeding the heated billet through a feed inlet adjacent to the two fourth end portions into the nip zone for rolling and forcing the semi-finished product to move through a feed outlet adjacent to the two second end portions; and
S3-3. repeating S3-2.
10. The method of claim 9, wherein the two main rolls and the two auxiliary rolls rotate at a speed ranging from 11 r/min to 13 r/min.
11. The method of claim 7, wherein a ratio of a diameter of the first protrusion portion to a diameter of the billet ranges from 1 to 5....

Claims

CLAIM
1. The ornamental design for an electronic hookah as shown and described....

Claims

What is claimed is:
1. A travel pillow, comprising:
a mounting assembly; and
a main body comprising a U-shaped case detachably connected to the mounting assembly;
wherein:
the mounting assembly comprises a cover, a U-shaped filler, and an inner frame; the cover, the U-shaped filler, and the inner frame are disposed sequentially from outside to inside; and the U-shaped filler is detachably attached to the U-shaped case;
the inner frame comprises an arc-shaped support body and two arms;
two ends of the arc-shaped support body comprise two first knuckles, respectively; and the travel pillow further comprises two rotary connectors connected to the two first knuckles, respectively;
each arm comprises a second knuckle; the first knuckle comprises a through hole; each rotary connector comprises a rotating shaft and a nut;
the rotating shaft comprises a threaded end and a rotating part;
the threaded end is in threaded connection to the nut; and the rotating shaft is disposed in the through hole;
the first knuckle is disposed between the nut and the second knuckle;
and the rotating part is disposed in the second knuckle; and
the two arms are rotatably disposed on both ends of the arc-shaped support body, respectively; and an included angle between the arc-shaped support body and each arm is adjustable.
2. The travel pillow of claim 1, wherein the mounting assembly is U-shaped and comprises an inner surface in contact with the U-shaped case; and the U-shaped case comprises an outer surface fitting in with the inner surface.
3. The travel pillow of claim 1, wherein the cover comprises an arc-shaped middle and two end parts; and the two end parts are formed integrally with or detachably connected to the arc-shaped middle.
4. The travel pillow of claim 1, wherein the U-shaped filler is detachably connected to the U-shaped case through a zipper; and the U-shaped filler comprises silicone or rubber.
5. The travel pillow of claim 1, wherein the U-shaped filler comprises a first groove; the arc-shaped support body comprises a first protrusion; and the first groove is detachably connected to the first protrusion.
6. The travel pillow of claim 5, wherein the U-shaped filler further comprises a second groove; each of the two arms comprises a second protrusion; and the second protrusion is detachably disposed in the second groove....

Claims

What is claimed is:
1. A travel pillow, comprising:
a main body;
a rotary frame disposed on an outer side of the main body; and
a casing detachably disposed on an outer side of the rotary frame;
wherein:
the rotary frame comprises a support arm, a rear support part, and an angle adjustment assembly; the support arm is rotatably connected to the rear support part, and the angle adjustment assembly is disposed between the support arm and the rear support part to adjust an angle between the support arm and the rear support part;
the angle adjustment assembly comprises a rotating shaft and a damper; the damper sleeves one end of the rotating shaft; the damper comprises a first fixing part and an adjustment end; the adjustment end comprises a plurality of adjustment sections disposed at equal intervals around the rotating shaft; each of the adjustment sections comprises a first adjustment section and a second adjustment section; the first adjustment section is closer to the first fixing part than the second adjustment section; and the first adjustment section has a greater outer diameter than the second adjustment section;
the support arm comprises a first socket ring, and the rear support part comprises a second socket ring; the first socket ring is connected to the support arm and sleeves the rotating shaft; and the second socket ring is connected to the rear support part and sleeves the rotating shaft; and
the rotating shaft comprises a second fixing part and a damping part which are disposed on both ends of the rotating shaft, respectively; the damper is detachably disposed around the damping part so as to rotate around the damping part; and the second fixing part comprises an external thread matched with a threaded nut.
2. The travel pillow of claim 1, wherein the damper further comprises a damping cover comprising an internal thread; and the first fixing part comprises an external thread matched with the internal thread.
3. The travel pillow of claim 1, wherein the second fixing part has an irregular shape; the second socket ring comprises a connection part matched with the second fixing part in shape; and the connection part sleeves the second fixing part.
4. The travel pillow of claim 1, wherein the second socket ring further comprises a first ring part and a second ring part; the rotating shaft is inserted through the second ring part, the first socket ring, and the second ring part successively, and is fixedly disposed to prevent the first socket ring from sliding off the rotating shaft.
5. The travel pillow of claim 1, wherein the travel pillow comprises a filler disposed between the rotary frame and the casing; and the filler comprises silicone....

Claims

CLAIM
1. The ornamental design for a storage shelf as shown and described....

Claims

What is claimed is:
1. A bioretention pond for rainwater treatment, comprising:
a pond body; and
an overflow weir;
wherein:
the pond body comprises a pond wall and a layered substrate;
the layered substrate comprises from bottom to top: a gravel layer, a transition layer, a pyrite layer, a plant layer, a pebble layer, an organic layer, and a water storage layer;
the overflow weir is disposed on the pebble layer with a space left above a center of the pebble layer;
the organic layer is disposed in the space and covers the pebble layer;
the water storage layer is disposed onto the organic layer; and
the pond body further comprises a perforated pipe, and one end of the perforated pipe is disposed in the gravel layer; and the perforated pipe comprises an outlet end which is flush with a top part of the pyrite layer.
2. The bioretention pond of claim 1, wherein the overflow weir comprises a plurality of outer plates and a plurality of inner plates, and a channel is formed by the plurality of outer plates and the plurality of inner plates; the plurality of outer plates is fixedly disposed on the pond wall; each of the plurality of inner plates comprises a first upper end and a first lower end, both of which comprises at least one telescoping pole; each of the plurality of outer plates comprises a second upper end and a second lower end, both of which comprises at least one threaded hole; the at least one telescoping pole comprises a threaded end connected to the at least one corresponding threaded hole.
3. The bioretention pond of claim 2, wherein one end of each of the plurality of inner plate comprises at least one hook; the other end of each of the plurality of inner plate comprises at least one groove; the at least one hook is latched on a corresponding at least one groove, so that every two adjacent inner plates are connected to each other.
4. The bioretention pond of claim 3, wherein the pond body further comprises an overflow pipe; the overflow pipe comprises an inlet end, and outlet end, two straight sections, and a 90 degree elbow; the two straight sections are connected to each other by the 90 degree elbow; one of the two straight sections is disposed in the plant layer; the other one of the two straight sections extends upward through the organic layer with the inlet end exposed to the water storage layer; and the outlet end is connected to a rainwater pipeline.
5. The bioretention pond of claim 4, wherein the bioretention pond for rainwater treatment further comprises a gravel drainage ditch disposed around the pond body; the gravel drainage ditch comprises a distal side and a proximal side lower than the distal side; the distal side is away from the pond wall, and the proximal side is near the pond wall; the overflow weir is covered with a filter plate; and at least one plant is planted on the plant layer.
6. The bioretention pond of claim 5, wherein the organic layer is an agricultural material comprising bark, sawdust, coconut husk, and corn cob; the agricultural material has a particle size of greater than 2 cm; and the organic layer has a thickness of 5-10 cm.
7. The bioretention pond of claim 6, wherein the pebble layer has a thickness of 5-10 cm and comprises pebbles with a particle size that is greater than 2 cm and less than the particle size of the agricultural material.
8. The bioretention pond of claim 7, wherein the plant layer comprises quartz sand and sandy loam mixed in a volume ratio of (14-17):(3-6); water flows through the plant layer at a seepage velocity of more than or equal to 150 mm/h; and the plant layer has a thickness of more than or equal to 30 cm.
9. The bioretention pond of claim 8, wherein the pyrite layer comprises quartz sand and pyrite mixed in a volume ratio of (6-8):(4-2); water flows through the pyrite layer at a seepage velocity of 250-350 mm/h; and the pyrite layer has a thickness of 20-50 cm....

Claims

What is claimed is:
1. A method for controlling operation of a permanent-magnet synchronous motor through sensorless vector control, the method comprising:
during operation of the permanent-magnet synchronous motor, receiving, by the permanent-magnet synchronous motor, a shutdown signal from an external device;
uninterruptedly outputting, by a microcontroller unit (MCU), a deceleration pulse to an inverter, instead of directly blocking a PWM pulse to the inverter, and constantly monitoring a control signal sent by the external device;
during a deceleration process, when the MCU receives a new startup signal and a real-time speed Vi of the permanent-magnet synchronous motor is greater than or equal to a reference speed Vref, controlling the permanent-magnet synchronous motor to rotate at a parameter approaching to a target torque T or a target speed V corresponding to the new startup signal from the real-time speed Vi;
blocking, by the MCU, the PWM pulse when the real-time speed Vi of the permanent-magnet synchronous motor is lower than the reference speed Vref;
wherein when the MCU blocks the PWM pulse, the permanent-magnet synchronous motor continues rotating due to inertia, and the control signal sent by the external device is constantly monitored; if, at this stage, the MCU receives another new startup signal, all lower bridge switch transistors are activated, causing the permanent-magnet synchronous motor to enter a dynamic braking mode for a duration t1; the MCU gives commands to input currents to the phase windings sequentially to lock a rotor position for a duration t2; and the permanent-magnet synchronous motor reenters into a sensorless startup state according to the new startup signal; and
wherein the permanent-magnet synchronous motor is a three-phase permanent-magnet synchronous motor with a three-phase winding comprising three sets of coils U, V, W; when the MCU blocks the PWM pulse and the MCU receives the new startup signal, three lower bridge switch transistors Q4, Q5, and Q6 are activated, causing the permanent-magnet synchronous motor to enter the dynamic braking mode for the duration t1; and the MCU gives commands to input currents to the three sets of coils U, V, and W sequentially to lock the rotor position for the duration t2.
2. The method of claim 1, wherein when the motor receives the shutdown signal from the external device, the MCU controls the motor to decelerate; when the shutdown signal exceeds or equals a set time duration t3, the MCU blocks the PWM pulses.
3. The method of claim 1, wherein the reference speed Vref is in the range of 200 to 400 rpm.
4. The method of claim 1, wherein the permanent-magnet synchronous motor rotates at the parameter approaching to the target speed V corresponding to the new startup signal from the real-time speed Vi with a step size V0 increasingly or decreasingly.
5. The method of claim 4, wherein the step size V0 is determined based on the rotational inertia and a difference between the real-time speed Vi and the target speed V corresponding to an acquired tap position signal....

Claims

What is claimed is:
1. A motor controller, comprising: a tap position selection circuit, a micro control unit (MCU), and an inverter circuit;
wherein:
the tap position selection circuit is configured to process a plurality of tap position signals transmit processed tap position signals to the MCU;
the MCU is configured to output signals to control the operation of the inverter circuit;
the inverter circuit comprises an output terminal connected to a plurality of coil windings of a stator module of a motor;
the tap position selection circuit comprises a plurality of first signal input circuits for motor start and a plurality of second signal input circuits for motor stop;
each tap position signal M is split into a first part and a second part; the first part is input into one first signal input circuit for motor start and the second part is input into one second signal input circuit for motor stop; and
the first signal input circuit for motor start and the second signal input circuit for motor stop output two level signals, IO-a and IO-b, respectively, to the MCU, and the MCU controls a start or stop state of the motor based on a magnitude of the two level signals, IO-a and IO-b.
2. The motor controller of claim 1, wherein the first signal input circuit for motor start has a first threshold voltage U1, and the second signal input circuit for motor stop has a second threshold voltage U2; a potential difference is present between the first threshold voltage U1 and the second threshold voltage U2; when a voltage of the tap position signal M is greater than the first threshold voltage U1, the level signal IO-a is high-level; when the voltage of the tap position signal M is less than the first threshold voltage U1, the level signal IO-a is low-level; similarly, when the voltage of the tap position signal M is greater than the second threshold voltage U2, the level signal IO-b is high-level, and when the voltage value of the tap position signal M is less than the second threshold voltage U2, the level signal IO-b is low-level.
3. The motor controller of claim 2, wherein the first signal input circuit for motor start comprises a resistor R3, a capacitor C5, a diode D1, a voltage regulator ZD1, a transistor Q1, an optocoupler chip U10, a capacitor C1, and a resistor R2; the tap position signal M is transmitted to a first input pin 1a of the optocoupler chip U10; the transistor Q1 comprises a first collector, a first emitter, and a first base; the first collector of the transistor Q1 is connected to a second input pin 2a of the optocoupler chip U10, and the first emitter of the transistor Q1 is grounded; one end of the resistor R3 is in series with one end of the voltage regulator ZD1, and the other end of the voltage regulator ZD1 is connected to the first base of the transistor Q1; the other end of the resistor R3 is in series with one end of the voltage regulator ZD1, and the other end of the voltage regulator ZD1 is connected to one end of the capacitor C5; the other end of the capacitor C5 is grounded; the tap position signal M is transmitted to the one end of the capacitor C5 through the diode D1; the capacitor C1 and the resistor R2 are connected in parallel; one end of a parallel combination of the capacitor C1 and the resistor R2 is connected to an output pin 3a of the optocoupler chip U10, and the other end of the parallel combination is grounded.
4. The motor controller of claim 3, wherein a magnitude of the first threshold voltage U1 is determined by the resistor R3 and the voltage regulator ZD1; when the diode D1 receives the tap position signal M, the capacitor C5 is charged; when a terminal voltage of the capacitor C5 exceeds the first threshold voltage U1, the transistor Q1 switches on, so that a connection among the first input pin 1a of the optocoupler chip U10, the second input pin 2a of the optocoupler chip U10, and the transistor Q1 is established, allowing the optocoupler chip U10 to output the level signal IO-a at high state; when the terminal voltage of the capacitor C5 is lower than the first threshold voltage U1, the transistor Q1 switches off, and no connection is established among the first input pin 1a of the optocoupler chip U10, the second input pin 2a of the optocoupler chip U10, and the transistor Q1; as a result, the optocoupler chip U10 outputs the level signal IO-a at low state.
5. The motor controller of claim 4, wherein the second signal input circuit for motor stop comprises a resistor R10, a capacitor C6, a diode D3, a voltage regulator ZD2, a transistor Q2, an optocoupler chip U20, a capacitor C3, and a resistor R9; the tap position signal M is transmitted to the first input pin 1b of the optocoupler chip U20; the transistor Q2 comprises a second collector, a second emitter, and a second base; the second collector of the transistor Q2 is connected to the second input pin 2b of the optocoupler chip U20, and the second emitter of the transistor Q2 is grounded; one end of the resistor R10 is in series with one end of the voltage regulator ZD2, and the other end of the voltage regulator ZD2 is connected to the second base of the transistor Q2; the other end of the resistor R10 is connected to one end of the capacitor C6, and the other end of the capacitor C6 is grounded; the tap position signal M is transmitted to the one end of the capacitor C6 through the diode D3; the capacitor C3 and the resistor R9 are connected in parallel; one end of the parallel combination is connected to the output pin 3b of the optocoupler chip U20, and the other end of the parallel combination is grounded.
6. The motor controller of claim 5, wherein a magnitude of the second threshold voltage U2 is determined by the resistor R10 and the voltage regulator ZD2; when the diode D3 receives the tap position signal M, the capacitor C6 is charged; when a terminal voltage of the capacitor C6 exceeds the second threshold voltage U2, the transistor Q2 switches on, so that a connection among the first input pin 1b of the optocoupler chip U20, the second input pin 2b of the optocoupler chip U20, and the transistor Q2 is established, allowing the optocoupler chip U20 to output the level signal IO-b at high state; when the terminal voltage of the capacitor C6 is lower than the second threshold voltage U2, the transistor Q2 switches off, and no connection is established among the first input pin 1b of the optocoupler chip U20, the second input pin 2b of the optocoupler chip U20, and the transistor Q2; as a result, the optocoupler chip U20 outputs the level signal IO-b at low state.
7. The motor controller of claim 6, wherein the first threshold voltage U1 is greater than the second threshold voltage U2.
8. The motor controller of claim 7, wherein the plurality of tap position signals comprise two tap position signals, M1 and M2.
9. A brushless direct current (BLDC) motor, comprising a motor and the motor controller of claim 1, and the motor comprising a stator, a rotor, and a housing....

Claims

What is claimed is:
1. An acceleration sensor, comprising:
an upper base plate;
a lower base plate; and
a gallium-based liquid metal encapsulated in graphene;
wherein:
the lower base plate comprises a first surface comprising at least one diamond channel, and the upper base plate comprises a second surface comprising a metal electrode corresponding to the at least one diamond channel in position;
the liquid metal is disposed in a center of the at least one diamond channel; the first surface is bonded to the second surface through an adhesive;
the liquid metal is movable in the at least one diamond channel and is in electrical contact with the metal electrode of the upper base plate during movement.
2. The acceleration sensor of claim 1, wherein the lower base plate comprises two diamond channels arranged in a cross pattern, and the upper base plate comprises four metal electrodes distributed along a cross line of the cross pattern.
3. The acceleration sensor of claim 1, wherein the lower base plate is an acrylic plate, the upper base plate is borosilicate glass, and the metal electrode is a symmetrical zigzag nickel chromium conductive layer.
4. The acceleration sensor of claim 2, wherein the lower base plate is an acrylic plate, the upper base plate is borosilicate glass, and the metal electrode is a symmetrical zigzag nickel chromium conductive layer.
5. A method for manufacturing the acceleration sensor of claim 1, the method comprising:
1) preparing the upper base plate and the lower upper base plate;
2) forming diamond channels on the lower base plate through deep reactive ion etching, modifying a surface of the diamond channels using a sandblasting system to form a serrated micro convex structure on side walls of the diamond channels; depositing a chromium layer as an adhesive layer on a glass base plate using an electron beam evaporator, depositing a nickel layer on the chromium layer; with a photoresist as an etching mask, etching the nickel layer and the chromium layer using a wet etchant to obtain a nickel chromium alloy electrode;
3) placing the liquid metal 5 encapsulated in graphene in the center of the diamond channels, and bonding the upper base plate and the lower base plate using a curable adhesive, to produce the acceleration sensor; and
4) testing the acceleration sensor, and calibrating an acceleration value of the acceleration sensor.
6. The method of claim 5, wherein 4) is performed as follows:
4.1) measuring an initial resistance of each metal electrode of the acceleration sensor using a DC resistance meter; placing the acceleration sensor in a fixed position of a centrifugal testing device;
4.2) controlling a rotational speed of a rotating plate of the centrifugal testing device, applying an acceleration from 0 to 2 g to the acceleration sensor, and synchronously recording resistance changes of the four metal electrodes, and monitoring a movement position of the liquid metal encapsulated in graphene in the diamond channel under a high-speed camera;
4.3) performing centrifugal experiments in two directions in sequence, applying different accelerations, and recording the resistance changes of the corresponding electrodes; and
4.4) based on collected experimental data, establishing a relationship between acceleration and the resistance changes of the metal electrodes, and calibrating a magnitude of acceleration using the resistance changes of the metal electrodes....

Claims

What is claimed is:
1. An insecticidal gun, comprising:
a gun body;
a feeding member;
a percussion member;
a trigger; and
an electric drive mechanism;
wherein:
the gun body comprises a launching chamber; the feeding member is slidably connected to the gun body and comprises a material storage chamber configured to communicate with the launching chamber;
the electric drive mechanism is configured to drive the percussion member to move in the launching chamber;
when the percussion member is driven by the electric drive mechanism to move, the feeding member moves along an axial direction of the gun body, so that the material storage chamber communicates with the launching chamber intermittently; and
the trigger is rotatable with respect to the gun body to activate or inactivate the electric drive mechanism.
2. The gun of claim 1, wherein the percussion member comprises a rack extending along the axial direction of the gun body; the electric drive mechanism comprises a motor disposed on the gun body and a gear set driven by the motor; and the gear set comprises a driving gear meshed with the rack.
3. The gun of claim 2, wherein the driving gear comprises a cam; the feeding member comprises a connecting rod extending to one side of the cam; when in use, the electric drive mechanism drives the percussion member to move, the cam leans against the connection rod to drive the feeding member on the gun body, and the material storage chamber communicates with the launching chamber; and
the insecticidal gun further comprises an elastic member disposed on one side of the feeding member and sleeving the gun body; when the cam is separated from the connection rod, the elastic member drives the feeding member to move, and the material storage chamber is disconnected with the launching chamber.
4. The gun of claim 3, wherein the feeding member comprises a storage member sleeving the gun body; the storage member comprises an accommodation space and the elastic member is disposed in the accommodation space.
5. The gun of claim 4, wherein a cross-section of the material storage chamber gradually increases in a direction away from the gun body.
6. The gun of claim 3, wherein the gun body further a guide groove, and the connecting rod is slidable in the guide groove.
7. The gun of claim 2, wherein the driving gear comprises a stop part; the trigger comprises a switching member disposed on one side of the stop part; the switching member is movable along the axial direction of the gun body to change between a single firing position and a continuous firing position; the trigger further comprises a firing seat configured to pushing against or detach from the switch; when the switching member is in a single firing position, the stop part abuts against the switching member and the firing seat detaches from the switch; the switching member comprises an active part abutting against the stop part; when moving to a continuous firing position, the switching member pushes the active part to move and release the stop part.
8. The gun of claim 1, wherein the gun body comprises a switch electrically connected to the electric drive mechanism on one side of the trigger; when rotating relative to the gun body, the trigger presses or releases the switch to open or close the electric drive mechanism.
9. The gun of claim 1, wherein the percussion member comprises one end extending into the launching chamber, and a seal ring is disposed on an outer wall of the end....

Claims

What is claimed is:
1. A method for promoting expression of a foreign gene in a plant, the method comprising: constructing a recombinant vector comprising a foreign gene operably linked to a soybean gene promoter pRPS28 or an intron-comprising soybean gene promoter pRPS28-I, and introducing the recombinant vector into the plant; the promoter pRPS28 being represented by SEQ ID NO: 2, and the intron-comprising promoter pRPS28-I being represented by SEQ ID NO: 3.
2. The method of claim 1, wherein the foreign gene is a beta-glucuronidase (GUS) gene.
3. The method of claim 1, wherein the plant is soybean, and the expression of the foreign gene occurs in cotyledons, radicles, plumules, true leaves, compound leaves, buds, petioles, internodes, roots and root nodules of the soybean.
4. The method of claim 1, wherein the plant is Arabidopsis, and the expression of the foreign gene occurs in whole plant, flower and pod of the Arabidopsis.
5. The method of claim 1, wherein the plant is tobacco, and the expression of the foreign gene occurs in leaves of the tobacco.
6. A method for preparing a recombinant vector comprising a soybean gene promoter, the method comprising inserting a soybean gene promoter pRPS28 or pRPS28-I into a vector pCAMBIA1391Z-BAR, wherein inserting the soybean gene promoter pRPS28 or pRPS28-I into the vector pCAMBIA1391Z-BAR comprises using a PCR amplification fragment of pRPS28 or pRPS28-I as a template, and cloning the PCR amplification fragment into a soybean stable transformation vector pCAMBIA1391Z-BAR by a seamless cloning method to obtain a soybean stable transformation vector pRPS28-GUS-BAR or pRPS28-I-GUS-BAR; wherein:
the vector pCAMBIA1391Z-BAR is obtained by linearizing a vector pCAMBIA1391Z with a restriction enzyme XhoI, and replacing a gene HygR with a gene BAR by the seamless cloning method;
the recombinant vector pRPS28-GUS-BAR is amplified using the following primers:
pRPS28-GUS-BAR-F:
(SEQ ID NO: 14)
GACCATGATTACGCCAAGCTTCACCACCCAATCCATAACCACCAC;
pRPS28-GUS-BAR-R:
(SEQ ID NO: 13)
CCAGTGAATTCCCGGGGATCCCTGATGCAAAACACGAACAAAGAAAG;
the recombinant vector pRPS28-I-GUS-BAR is amplified using the following primers:
pRPS28-I-GUS-BAR-F:
(SEQ ID NO: 14)
GACCATGATTACGCCAAGCTTCACCACCCAATCCATAACCACCAC;
pRPS28-I-GUS-BAR-R:
(SEQ ID NO: 15)
CCAGTGAATTCCCGGGGATCC CCTGCTCAAACACAATCAACAG; and
the promoter pRPS28 has the nucleotide sequence of SEQ ID NO: 2, and the promoter pRPS28-I has the nucleotide sequence of SEQ ID NO: 3....

Claims

What is claimed is:
1. An electronic control actuator, comprising:
a lower housing and an upper housing, the lower housing or the upper housing comprising a plurality of first matching holes, and the lower housing and the upper housing cooperating to form an installation space;
an isolation plate disposed between the lower housing and the upper housing, the isolation plate comprising a plurality of second matching holes, and a plurality of locating pins respectively passing through the plurality of first matching holes and the plurality of second matching holes; and
a compact gear assembly and a drive motor both disposed in the installation space, and the compact gear assembly being cooperatively connected to the drive motor;
wherein:
the compact gear assembly comprises:
a first reduction gear, in transmission connection to a motor shaft of the drive motor at a first location;
a second reduction gear, fixedly coaxially connected to the first reduction gear; and
a sector gear, the sector gear being meshed with the second reduction gear at a second location; the sector gear being coaxially rotationally connected to an output shaft; and the sector gear comprising a matching groove;
the motor shaft extends through the matching groove in the sector gear; the second reduction gear is disposed between the drive motor and the first reduction gear; whereby both the second reduction gear and the sector gear are disposed between the drive motor and the first reduction gear; and the second location is disposed adjacent to the drive motor with respect to the first location along an axial direction of the motor shaft;
the lower housing comprises a limiting part disposed on one side of the locating pins away from the first matching holes; the limiting part comprises a support surface, and when the lower housing is cooperatively connected to the upper housing, the support surface abuts against one side of the isolation plate away from the first matching holes; and
the lower housing comprises a side wall, a motor-mounting part, an air-cooled element, and a water-cooled element; the motor-mounting part is disposed in a middle of the side wall; the air-cooled element is disposed around the motor-mounting part; the water-cooled element is disposed in the side wall and corresponds to the air-cooled part; and the water-cooled element is disposed around the motor-mounting part.
2. The electronic control actuator of claim 1, wherein the first matching holes are two in number, and are disposed along a diagonal of the lower housing or the upper housing.
3. The electronic control actuator of claim 1, wherein the matching groove is an arc-shaped structure, and a distance between a motion trajectory of the motor shaft within the arc-shaped structure and a root circle of the sector gear is constant.
4. The electronic control actuator of claim 3, further comprising:
the output shaft, disposed on the upper housing and coaxially rotationally connected to the sector gear;
a locating part sleeving the output shaft; and
an elastic member sleeving the output shaft, the elastic member comprising a first end and a second end opposite to the first end, and the first end being connected to the locating part, and the second end being cooperatively connected to the upper housing.
5. The electronic control actuator of claim 4, wherein one side of the locating part facing the elastic member comprises a first groove, and the first end is cooperatively limited in the first groove; the upper housing comprises a second groove, and the second end is cooperatively limited in the second groove; and the locating part is rotatable along with the rotation of the output shaft.
6. An exhaust gas treatment system, comprising the electronic control actuator of claim 1.
7. The system of claim 6, further comprising an exhaust gas circulation pipeline and a valve disposed on the exhaust gas circulation pipeline, wherein the electronic control actuator is configured to control the opening or closing of the valve.
8. A vehicle, comprising the exhaust gas treatment system of claim 6....

Claims

What is claimed is:
1. A supporting device for a punching bag, comprising:
1) a hollow tubular pillar;
2) a connector;
3) a flange body;
4) a rubber shock absorber; and
5) a support tray;
wherein:
the connector is tubular, and comprises a first end and a second end; the second end is bigger than the first end in diameter; the first end is disposed into the hollow tubular pillar; the connector comprises a first connection hole, and the hollow tubular pillar comprises a second connection hole; the connector and the hollow tubular pillar are fixed by a locking screw through the first connection hole and the second connection hole;
the flange body comprises a central blind hole, and the second end of the connector is disposed into the central blind hole;
the flange body further comprises a radial base; a circumference of the radial base comprises a plurality of mounting holes configured to receive a counterweight unit to stabilize the supporting device;
the support tray is a disc structure, comprising at least two support rods; one end of each support rod is fixed to the hollow tubular pillar, and the other end is fixed to the support tray; and the support tray is configured to support a punching bag body; and
the rubber shock absorber comprises a central hole; the hollow tubular pillar is disposed through the central hole; and the rubber shock absorber is disposed below and leans against the support tray.
2. The device of claim 1, wherein a periphery of the support tray is bent upwards by 90 degrees to form a smooth contact surface.
3. The device of claim 1, wherein the first end of the connector is a shrinking end towards the hollow tubular pillar thus facilitating a connection between the connector and the hollow tubular pillar.
4. The device of claim 1, wherein a step is disposed in the central blind hole of the flange body to divide the central blind hole into a first part and a second part, and a size of the first part is larger than that of the second part; the locking screw is located in the first part and supported by the step, and the second end of the connector is firmly fixed in the second part....