Claims

What is claimed is:
1. An adjustable constant pressure device, comprising:
a connector;
a sealing shaft;
a constant pressure assembly; and
a mobile mechanism;
wherein,
the connector comprises an axially extended assembly channel; the sealing shaft and the constant pressure assembly are disposed in the assembly channel;
the sealing shaft comprises a sealing channel and an air outlet communicating with the sealing channel;
the constant pressure assembly comprises one end axially oriented to the air outlet, and the end is sealed;
the constant pressure assembly comprises a constant pressure channel; when an air pressure in the constant pressure channel is higher than that in the sealing channel, the constant pressure assembly moves along the assembly channel to seal the air outlet; when the air pressure in the constant pressure channel is lower than that in the sealing channel, the constant pressure assembly moves along the assembly channel to open the air outlet; and
the mobile mechanism is connected to the connector and the sealing shaft, and is configured to move to drive the sealing shaft to move along the assembly channel.
2. The device of claim 1, wherein the mobile mechanism comprises an adjusting wheel annularly disposed on the connector and a moving member attached to the sealing shaft; the adjusting wheel is rotatable relative to the connector, and when the adjusting wheel rotates relative to the connector, the moving member drives the sealing shaft to move along the assembly channel.
3. The device of claim 2, wherein the connector comprises a guide channel; the moving member is extended into and limited in the guide channel, and is unable to rotate with respect to the connector; the moving member extends from the sealing shaft along the guide channel to one side of the adjusting wheel and is in threaded connection to the adjusting wheel, and when the adjusting wheel rotates, the moving member moves along the guide channel.
4. The device of claim 3, wherein the guide channel runs through the connector in a radial direction of the connector, and the moving member is disposed through the connector along the guide channel and is in threaded connection to the adjustment wheel; and/or, the moving member is in threaded connection to the sealing shaft.
5. The device of claim 4, wherein the guide channel divides the assembly channel into a front channel and a rear channel; the front channel communicates with the guide channel via a front opening; the rear channel communicates with the guide channel via a rear opening; the constant pressure assembly is disposed in the front channel; when the moving member approaches to one side of the front opening or one side of the rear opening, two ends of the sealing shaft are respectively inserted into the front channel and the rear channel.
6. The device of claim 3, wherein the sealing shaft is annularly provided with two seals; the two seals are against the sealing shaft and the assembly channel, respectively, and the guide channel is located between the two seals; an outer wall of the sealing shaft comprises two sealing grooves, and two seals are embedded in the two sealing grooves, respectively.
7. The device of claim 2, wherein the connector comprises a stop ring and a front housing which are respectively disposed on two sides of the adjusting wheel; the stop ring and the front housing are spaced apart in an axial direction of the connector to restrict an axial movement of the adjusting wheel on the connector.
8. The device of claim 7, wherein the stop ring protrudes from an outer surface of the connector and is integrated with the connector; the front housing is annularly disposed on the connector and in threaded connection to the connector; the front housing comprises an air discharge passage communicating with the constant pressure channel, and the front housing comprises a bleeder valve connected to the air discharge passage; and/or
the connector comprises a rear housing on one side of the stop ring away from the front housing; the rear housing is located outside the connector and in threaded connection to the connector; the rear housing comprises an air inlet passage communicating with the sealing channel; an air inlet valve is disposed on the rear housing and connected to the air inlet passage, and an air pressure gauge is disposed on one side of the air inlet valve.
9. The device of claim 2, wherein an outer surface of the adjusting wheel comprises a plurality of non-slip grooves.
10. The device of claim 1, wherein the constant pressure assembly comprises a constant pressure shaft, a seal head, and a disc spring; the constant pressure shaft is disposed in the assembly channel; the constant pressure channel is axially disposed in the constant pressure shaft; the constant pressure shaft comprises an air inlet communicating with the constant pressure channel and the assembly channel; the seal head is embedded in one end of the constant pressure assembly and faces the air outlet; the seal head is spaced apart from the assembly channel; a portion of the constant pressure shaft from the seal head to the air inlet is spaced apart from the assembly channel; the disc spring is annularly disposed on the constant pressure shaft to actuate the constant pressure shaft to move toward the sealing shaft to seal the air outlet....

Claims

The invention claimed is:
1. A device, comprising:
three rollers, the three rollers being circumferentially evenly distributed along a rolling line which is a straight line of a moving direction of a billet being rolled, wherein the three rollers are of unequal diameter rotating structure and each roller has a small end and a big end; three small ends of the three rollers are located at a first end of the device, and three big ends of the three rollers are located at a second end; and the three rollers are rotatable around their own axis;
three guide plates, each guide plate being disposed between every two adjacent rollers, the three guide plates rotatably abutting against the three rollers, and being circumferentially evenly distributed along the rolling line;
a plug, the plug being disposed in a forming space formed by the three rollers and three guide plates, wherein, the forming space is cylindrical, and an axis of the plug is coincident with the rolling line; the plug is an unequal diameter rotating structure having a small end and a big end; and the small end of the plug is located in an opening of the forming space, and the opening is a feed port of the billet; and
the three rollers comprise two first rollers and one second roller; the two first rollers and the second roller are the same in shape; the two first rollers are the same in dimensions; a diameter of the two first rollers is less than that of the second roller in a plane parallel to the rolling line; and the small ends of the two first rollers and the small end of the second roller are located at the small end of the plug.
2. The device of claim 1, wherein the three rollers are the same in dimensions; and, the small end of the plug is disposed at the first end of the device, or the small end of the plug is disposed at the second end of the device.
3. A method for wall reduction and uniformation using the device of claim 1, the method comprising rotating the three rollers around their own axis in a revolving speed, feeding the billet from the small end to the big end of the plug into the forming space to contact the three rollers, driving the billet to move forward spirally along the rolling line to further contact the plug for wall reduction and uniformation, and outputting a final product from a gap formed by the three rollers, the three guide plates, and the plug.
4. The method of claim 3, further comprising heating the billet prior to being rolled.
5. A device, comprising:
three rollers, the three rollers being circumferentially evenly distributed along a rolling line which is a straight line of a moving direction of a billet being rolled, wherein the three rollers are of unequal diameter rotating structure and each roller has a small end and a big end; three small ends of the three rollers are located at a first end of the device, and three big ends of the three rollers are located at a second end; and the three rollers are rotatable around their own axis;
three guide plates, each guide plate being disposed between every two adjacent rollers, the three guide plates rotatably abutting against the three rollers, and being circumferentially evenly distributed along the rolling line;
a plug, the plug being disposed in a forming space formed by the three rollers and three guide plates, wherein, the forming space is cylindrical, and an axis of the plug is coincident with the rolling line; the plug is an unequal diameter rotating structure having a small end and a big end; and the small end of the plug is located in an opening of the forming space, and the opening is a feed port of the billet; and
a unit pitch t of a rolled piece of the billet is:
T
=
π
·
η
0
·
D
·
tg
⁢
β
;
wherein:
β is a feed angle; D is a diameter of the billet; η0 is an axial slip coefficient at an outlet of the device;
along the rolling line, the plug comprises a preparation section, a wall reduction section, a uniform section, and a circular section;
diameters of the preparation section, the wall reduction section, and the uniform section increase sequentially; an axial length of the preparation section is 0.4-0.6 t, an axial length of the uniform section is 2.0-2.5 t, and the axial length of the circular section is 0.9-1.1 t.
6. The device of claim 5, wherein a minimum diameter of the preparation section is 2R1, and a diameter at the connection between the preparation section and the wall reduction section is 2R2; the wall reduction section comprises a first wall reduction section and a second wall reduction section; the preparation section is connected to the first wall reduction section, and a connection between the first wall reduction section and the second wall reduction section is 2R3; the second wall reduction section is connected to the uniform section; a diameter at the connection between the uniform section and the circular section is 2R4; a wall reduction amount of the first wall reduction section is ΔS1; a wall reduction amount of the second wall reduction section is ΔS2, and a total wall reduction amount of the wall reduction section is ΔS:
Δ
⁢
S
=
Δ
⁢
S
1
+
Δ
⁢
S
2
;
R
3
=
D
·
(
1
-
I
)
2
-
(
S
-
Δ
⁢
S
1
)
;
D is a diameter of the billet; S is a wall thickness of the billet; I is a reduction amount of the rolled piece; the reduction amount I of the rolled piece is 17% to 21%, and a front reduction amount W of the plug is 16% to 20%, and ΔS1/ΔS2 is in the range of 0.5 to 2.
7. The device of claim 6, wherein outer walls of the wall reduction section and the circular section are curved surfaces.
8. The device of claim 5, wherein the three rollers are the same in dimensions; and, the small end of the plug is disposed at the first end of the device, or the small end of the plug is disposed at the second end of the device.
9. A method for wall reduction and uniformation using the device of claim 5, the method comprising rotating the three rollers around their own axis in a revolving speed, feeding the billet from the small end to the big end of the plug into the forming space to contact the three rollers, driving the billet to move forward spirally along the rolling line to further contact the plug for wall reduction and uniformation, and outputting a final product from a gap formed by the three rollers, the three guide plates, and the plug.
10. The method of claim 9, further comprising heating the billet prior to being rolled.
11. A device, comprising:
three rollers, the three rollers being circumferentially evenly distributed along a rolling line which is a straight line of a moving direction of a billet being rolled, wherein the three rollers are of unequal diameter rotating structure and each roller has a small end and a big end; three small ends of the three rollers are located at a first end of the device, and three big ends of the three rollers are located at a second end; and the three rollers are rotatable around their own axis;
three guide plates, each guide plate being disposed between every two adjacent rollers, the three guide plates rotatably abutting against the three rollers, and being circumferentially evenly distributed along the rolling line;
a plug, the plug being disposed in a forming space formed by the three rollers and three guide plates, wherein, the forming space is cylindrical, and an axis of the plug is coincident with the rolling line; the plug is an unequal diameter rotating structure having a small end and a big end; and the small end of the plug is located in an opening of the forming space, and the opening is a feed port of the billet; and
each of the three rollers comprises a first roller body and a second roller body; a big end of the first roller body is connected to a small end of the second roller body to form a roller throat; a ratio of a diameter of the roller throat to a diameter of the billet is between 1 and 3; a ratio of an axial length of the three rollers to the diameter of the roller throat is between 1.5 and 3.5; a ratio of an axial length of the first roller body to an axial length of the second roller body is 3:5; a cone angle of the three rollers is 3.5° to 5°, and a rolling angle of the three rollers is 11° to 13°.
12. The device of claim 11, wherein a joint between the first roller body and the second roller body is chamfered, with a chamfer radius of not less than 500 mm.
13. The device of claim 11, wherein the three rollers are the same in dimensions; and, the small end of the plug is disposed at the first end of the device, or the small end of the plug is disposed at the second end of the device.
14. A method for wall reduction and uniformation using the device of claim 11, the method comprising rotating the three rollers around their own axis in a revolving speed, feeding the billet from the small end to the big end of the plug into the forming space to contact the three rollers, driving the billet to move forward spirally along the rolling line to further contact the plug for wall reduction and uniformation, and outputting a final product from a gap formed by the three rollers, the three guide plates, and the plug.
15. The method of claim 14, further comprising heating the billet prior to being rolled....

Claims

What is claimed is:
1. A method of preparing a cutting tool, the method comprising:
1. Putting a silicon nitride (Si3N4) ceramic substrate in a hexane suspension mixed with diamond powders, and ultrasonically vibrating the hexane suspension, to grow diamond seeds on the Si3N4 ceramic substrate, wherein the Si3N4 ceramic substrate further comprises TiN particles; and
2. Ultrasonically cleaning the Si3N4 ceramic substrate in acetone for 3-8 min, and then in 92-98% anhydrous alcohol for 2-4 min; drying the Si3N4 ceramic substrate and placing the Si3N4 ceramic substrate in a hot-wire chemical vapor deposition (CVD) vessel to produce the cutting tool;
wherein
the cutting tool comprises a diamond film coated on a surface of the Si3N4 ceramic substrate, and the diamond film having a thickness of 7-12 μm, an arithmetic average roughness (Ra) value of 8.1 nm, and a root mean square roughness (RMS) value of 8.6 nm.
2. The method of claim 1, wherein prior to 1), a rake face of the silicon nitride (Si3N4) ceramic substrate is grinded in a diamond slurry on a cast iron grinding plate, and then the rake face is roughened in a nano size by CF4 plasma dry etching.
3. The method of claim 1, wherein in 2), the hot-wire chemical vapor deposition (CVD) vessel operates with the following parameters: a filament temperature of 2000-2400° C., a substrate temperature of 750-800° C., a total pressure of 3.0-5.0 kPa, a total flow of 300-350 sccm, a volume ratio of CH4/H2 of 1-3%, and a deposition time of 6-10 h.
4. The method of claim 1, wherein a particle size of the diamond powders is 0.5-1 μm....

Claims

What is claimed is:
1. A counterweight base for a punching bag, comprising a counterweight body, a conical connector, and a plurality of suction discs;
wherein:
the counterweight body is a one-piece barrel-shaped container in the form of a flat cylinder, and comprises a platform and an accommodating cavity;
an upper part of the counterweight body protrudes to form a circular truncated cone, and the platform is disposed in a center of a top surface of the circular truncated cone; the accommodating cavity is disposed in a center of a bottom part of the counterweight body;
the accommodating cavity comprises a bottom opening that tapers inward, and is in the shape of a conical column;
the conical connector is matched with the accommodating cavity in size and shape, and comprises a flange base; a step is disposed in the bottom opening of the accommodating cavity; in a storage state of the counterweight base, the conical connector is disposed in the accommodating cavity, and the flange base is supported by the step;
a plurality of first inbuilt nuts are disposed on the platform; the flange base comprises a plurality of mounting holes; in a use state of the counterweight base, the conical connector is fixed on the platform through the plurality of first inbuilt nuts passing through the plurality of mounting holes; and
a plurality of second inbuilt nuts are disposed on a bottom end face of the counterweight base, and the plurality of suction discs are attached to the counterweight base through the plurality of second inbuilt nuts, respectively.
2. The counterweight base for a punching bag of claim 1, wherein a plurality of radial grooves are disposed on an inner side wall of the counterweight body and the bottom end face of the counterweight body; a plurality of strengthening ribs protrude from an outer surface of the conical connector; and the plurality of strengthening ribs are embedded in the radial grooves on the inner side wall of the counterweight body, respectively.
3. The counterweight base for a punching bag of claim 1, wherein a plurality of third inbuilt nuts are disposed on the step; a baffle plate is fixed on the step through the plurality of third inbuilt nuts; the suction discs are further disposed on the baffle plate; and a thickness of the baffle plate is equal to a depth of the step.
4. The counterweight base for a punching bag of claim 1, wherein a conical surface of the counterweight body below the platform is a decorative surface; and the decorative surface comprises a plurality of evenly distributed patterns with alternating uplifts and sags.
5. The counterweight base for a punching bag of claim 1, wherein the counterweight body is an integrated structure formed by plastic injection molding.
6. The counterweight base for a punching bag of claim 1, wherein the upper part of the counterweight body comprises a top opening and a cover....

Claims

What is claimed is:
1. An inflatable active packer, comprising:
an inner steel pile of a cylindrical shape;
a sleeve of a cylindrical shape and coaxially disposed outside the inner steel pile; the sleeve comprising an inner cylindrical wall;
a cylindrical clamping layer;
a rubber capsule;
a plurality of assemblies; and
a charging nozzle;
wherein:
an inner diameter of the sleeve is larger than an outer diameter of the inner steel pile;
a length of the sleeve is less than or equal to a length of the inner steel pile;
one end of the inner cylindrical wall of the sleeve is provided with a guide lug;
the cylindrical clamping layer is attached to the inner cylindrical wall of the sleeve;
the rubber capsule comprises the cylindrical clamping layer and a bulgy portion; the bulgy portion extends from a middle portion of the cylindrical clamping layer towards the inner steel pile; wherein an annular space is enclosed by the bulgy portion and the cylindrical clamping layer;
two ends of the cylindrical clamping layer are fixedly connected to the sleeve through the plurality of assemblies:
a mounting hole is disposed in a middle position of the cylindrical clamping layer;
the sleeve comprises a through hole coaxially with the mounting hole, and the through hole has the same diameter as the mounting hole; and
the charging nozzle is disposed in the through hole and the mounting hole; and the charging nozzle is disposed through the sleeve and the cylindrical clamping layer, and into the rubber capsule;
each of the plurality of assemblies comprises a recessed pressing plate, a first gasket, and a fastening bolt;
the two ends of the cylindrical clamping layer each comprises a protruding buckle; each protruding buckle on the cylindrical clamping layer is clamped in the recessed pressing plate on one of the plurality of assemblies; and
for one of the plurality of assemblies, the recessed pressing plate is connected to the sleeve through the fastening bolt, and the first gasket is disposed between the recessed pressing plate and the sleeve.
2. The packer of claim 1, wherein two seal grooves are respectively disposed on the inner wall and outer wall of the sleeve; the two seal grooves are coaxial with the charging nozzle; each of the two seal grooves is provided with a sealing gasket, and each sealing gasket sleeves the charging nozzle.
3. The packer of claim 1, wherein the cylindrical clamping layer and the bulgy portion of the rubber capsule comprise one or more layers of cloth rubber.
4. The packer of claim 1, wherein a thickness of each of the plurality of assemblies is not greater than that of the guide lug.
5. The packer of claim 1, wherein when the rubber capsule is unfilled with a filler, a total thickness of the rubber capsule is not greater than that of the guide lug.
6. The packer of claim 5, wherein the filler is gas or liquid.
7. The packer of claim 1, wherein a top end of the guide lug is inclined downwards from the inner wall of the sleeve to an axis of the sleeve.
8. An inflatable active packer, comprising:
an inner steel pile of a cylindrical shape;
a sleeve of a cylindrical shape and coaxially disposed outside the inner steel pile; the sleeve comprising an inner cylindrical wall;
a cylindrical clamping layer;
a rubber capsule;
a plurality of assemblies; and
a charging nozzle;
wherein:
an inner diameter of the sleeve is larger than an outer diameter of the inner steel pile;
a length of the sleeve is less than or equal to a length of the inner steel pile;
one end of the inner cylindrical wall of the sleeve is provided with a guide lug;
the cylindrical clamping layer is attached to the inner cylindrical wall of the sleeve;
the rubber capsule comprises the cylindrical clamping layer and a bulgy portion; the bulgy portion extends from a middle portion of the cylindrical clamping layer towards the inner steel pile; wherein an annular space is enclosed by the bulgy portion and the cylindrical clamping layer;
two ends of the cylindrical clamping layer are fixedly connected to the sleeve through the plurality of assemblies;
a mounting hole is disposed in a middle position of the cylindrical clamping layer;
the sleeve comprises a through hole coaxially with the mounting hole, and the through hole has the same diameter as the mounting hole; and
the charging nozzle is disposed in the through hole and the mounting hole; and the charging nozzle is disposed through the sleeve and the cylindrical clamping layer, and into the rubber capsule;
the two ends of the cylindrical clamping layer each comprises a straight bar;
each of the plurality of assemblies comprises an L-shaped pressing plate, a gasket, and a fastening bolt;
each straight bar on the cylindrical clamping layer abuts against the L-shaped pressing plate on one of the plurality of concave assemblies; and
for one of the plurality of assemblies, the L-shaped pressing plate is connected to the sleeve through the fastening bolt, and the gasket is disposed between the L-shaped pressing plate and the sleeve.
9. An inflatable active packer, comprising:
an inner steel pile of a cylindrical shape;
a sleeve of a cylindrical shape and coaxially disposed outside the inner steel pile; the sleeve comprising an inner cylindrical wall;
a cylindrical clamping layer;
a rubber capsule;
a plurality of assemblies; and
a charging nozzle;
wherein:
an inner diameter of the sleeve is larger than an outer diameter of the inner steel pile;
a length of the sleeve is less than or equal to a length of the inner steel pile;
one end of the inner cylindrical wall of the sleeve is provided with a guide lug;
the cylindrical clamping layer is attached to the inner cylindrical wall of the sleeve;
the rubber capsule comprises the cylindrical clamping layer and a bulgy portion; the bulgy portion extends from a middle portion of the cylindrical clamping layer towards the inner steel pile; wherein an annular space is enclosed by the bulgy portion and the cylindrical clamping layer;
two ends of the cylindrical clamping layer are fixedly connected to the sleeve through the plurality of assemblies;
a mounting hole is disposed in a middle position of the cylindrical clamping layer;
the sleeve comprises a through hole coaxially with the mounting hole, and the through hole has the same diameter as the mounting hole; and
the charging nozzle is disposed in the through hole and the mounting hole; and the charging nozzle is disposed through the sleeve and the cylindrical clamping layer, and into the rubber capsule;
the charging nozzle is a threaded structure; a valve block is in threaded connection to a part of the charging nozzle exposed out of the sleeve; the valve block comprises a first axial end abutting against the sleeve, and a second axial end abutting against a tight nut; the tight nut is in threaded connection to the charging nozzle; the valve block comprises a unidirectional air passage; the unidirectional air passage is disposed through the valve block and an air passage of the charging nozzle; a valve is fixedly disposed on both an inlet end and an outlet end of the unidirectional air passage; one end of the valve away from the unidirectional air passage is fixedly connected to an inflating flexible tube, and one end of the inflating flexible tube away from the unidirectional air passage is connected to an air source....

Claims

What is claimed is:
1. A road paver, comprising:
a head;
a body comprising a front end and a tail end;
a feeding device, disposed in the front end to convey polyurethane concrete, and the feeding device comprising a stirring device;
a stone paving device, disposed on the tail end to spread crushed stone over a road, and the stone paving device comprising a stone feed bin carrying the crushed stone; and
a concrete paving device, disposed between the feeding device and the stone paving device and connected to the stirring device, and used to spread the polyurethane concrete across the road;
wherein:
the feeding device further comprises:
a power system disposed on one side of the head of the road paver to power the feeding device;
a transmission system disposed on one side of the stirring device, and being driven by the power system to convey aggregates of the polyurethane concrete through a convey belt;
a collecting system, being connected to the stirring device and the transmission system and guiding the aggregates from the convey belt of the transmission system to the stirring device; and
the collecting system comprises a first open end and a second open end; the first open end is connected to the transmission system and has a greater width than the convey belt of the transmission system; and the second end is connected to the stirring device and has a smaller width than the stirring device;
the concrete paving device comprises:
a feed hopper, disposed below the stirring device to receive the polyurethane concrete from the stirring device;
a concrete feed bin connected to the feed hopper to hold the polyurethane concrete; and
an unloading hopper disposed below the concrete feed bin; and
when in operation, the polyurethane concrete is laid down on the road via the unloading hopper; the unloading hopper comprises a first side close to the feed hopper and a second side close to the stone paving device; a distance between the first side and the road is less than a distance between the second side and the road.
2. The road paver of claim 1, wherein the stirring device comprises:
a housing, connected to the feeding device and used to receive the polyurethane concrete from the feeding device;
a rotating member, disposed in the housing;
at least two helical blades, used to stir and transport the polyurethane concrete; and
a stirring member, disposed between the at least two helical blades to stir the polyurethane concrete; and
the at least two helical blades and the stirring member are connected to the rotating member.
3. The road paver of claim 1, wherein the concrete paving device further comprises:
a screed, disposed on a rear end of the concrete paving device to flatten the polyurethane concrete; and
a vibrator, disposed in front of the screed to compact the polyurethane concrete.
4. The road paver of claim 1, wherein the concrete paving device further comprises a screw conveyor disposed in the concrete feed bin to spread the polyurethane concrete across the road.
5. The road paver of claim 1, wherein the concrete paving device further comprises a road grader used to maintain a stable forward movement of the stone paving device.
6. The road paver of claim 1, wherein the stone paving device further comprises:
a running gear, disposed at a bottom portion of the stone paving device to carry the stone paving device to move; and
a speed sensor, disposed on the running gear to measure and adjust an operating speed of the running gear.
7. The road paver of claim 1, wherein the stone paving device further comprises:
a stone conveyor, disposed in the stone feed bin to drive small rocks to move;
a paving roller, disposed below the stone conveyor to spread the crushed stone into the polyurethane concrete; and
a driving device, disposed on a frame of the stone paving device and connected to the paving roller to drive the rotation of the paving roller.
8. The road paver of claim 1, wherein the feeding device further comprises:
a first measuring member, disposed between the power system and the transmission system to hold the aggregates; and the aggregates are transported into the stirring device through the transmission system; and
a second measuring member, disposed between the first measuring member and the power system and comprising at least two measuring boxes used to hold polyurethane; and a certain amount of polyurethane is poured into the stirring device under control of the at least two measuring boxes....

Claims

What is claimed is:
1. A height measurement system, comprising:
1) a first fixed assembly, configured to connect to an external fixing part so that the height measurement system is fixed on the external fixing part for use;
2) a head plate, configured to move downwards from the first fixed assembly to the head of a user;
3) a second fixed assembly, disposed on the head plate and being movable along with the heat plate;
4) a digital tape measure, comprising a mounting assembly and a tape disposed in the mounting assembly, one of the mounting assembly and the tape head being attached to the first fixing assembly and the other to the second fixing assembly;
5) a memory storing a standard height value of the first fixed assembly connected to the external fixing part; and
6) a data acquisition unit, configured to acquire a first tensile length of the tape when the head plate moves from the first fixed assembly to a top of the user's head, and transmitting the first tensile length to the memory, and the memory being configured to calculate the height of the user according to the standard height value and the first tensile length of the tape.
2. The system of claim 1, further comprising a data receiving device configured to receive an actual height value of the first fixed assembly attached to the external fixing part; and the memory being configured to calculate the height of the user according to the actual height value and the first tensile length of the tape.
3. The system of claim 2, wherein the memory is further configured to determine whether the actual height value from the data receiving device is received before calculating the height of the user; if so, the height of the user is calculated based on the actual height value and the first tensile length.
4. The system of claim 2, wherein the data receiving device disposed on the mounting assembly or an intelligent terminal independent of the height measurement system.
5. The system of claim 1, further comprising a data receiving device configured to receive a preset height value of the head plate; wherein
the data acquisition unit is configured to obtain a second tensile length of the tape when the head plate moves from the preset height value to the top of the user's head, and transmit the second tensile length to the memory; and
the memory is configured to calculate the height of the user according to the preset height value and the second tensile length of the tape.
6. The system of claim 5, wherein the memory is further configured to determine whether the preset height value from the data receiving device is received before calculating the height of the user, and if so, the height of the user is calculated based on the preset height value and the second tensile length.
7. The system of claim 6, wherein the data acquisition unit is a capacitive gate sensor.
8. The system of claim 7, wherein the capacitive gate sensor is disposed on the mounting assembly.
9. The system of claim 1, wherein the memory is disposed on the mounting assembly or an intelligent terminal independent of the height measurement system.
10. The system of claim 1, further comprising a result output device, wherein the memory is further configured to transmit the obtained height of the user to the result output device, and the result output device is configured to output the height of the user.
11. The system of claim 1, further comprising an information receiving device configured to receive instructions and configuration information; wherein
the memory is further configured to receive the instructions and configuration information from the information receiving device and transmit the instructions and configuration information to the result output device; and
the result output device is further configured to output corresponding content according to the instructions and configuration information.
12. The system of claim 11, wherein the result output device is disposed on the mounting assembly and/or an intelligent terminal independent of the height measurement system; and/or
the information receiving device is disposed on the mounting assembly and/or an intelligent terminal independent of the height measurement system.
13. The system of claim 1, wherein the memory is also configured to compare the obtained height of the user with a previously obtained height of the user, and/or to compare the obtained height of the user with a standard value.
14. The system of claim 1, further comprising a sticky graduation attached to the external fixing part, and the first fixed assembly being disposed on the sticky graduation.
15. The system of claim 1, wherein the mounting assembly is connected to the first fixed assembly; the tape head is connected to the second fixed assembly; the first fixed assembly comprises a paster, a female buckle, a male buckle, and a housing; the paster is connected the external fixing part; the female buckle is fixed on one side of the paster; the male buckle is detachably connected to the female buckle and is disposed on the female buckle; the housing is fixedly connected to the male buckle; the digital tape measure is disposed in the housing.
16. The system of claim 15, wherein the housing comprises a plurality of grooves.
17. The system of claim 15, further comprising a magnetic sticker; wherein the magnetic sticker is connected to the paster and is disposed on one side of the paster away from the female buckle.
18. The system of claim 1, wherein the mounting assembly is connected to the first fixed assembly, and the tape head is connected to the second fixed assembly; the second fixed assembly comprises a buckle and a limit base fixedly connected to the head plate; the limit base is disposed on the head plate; the buckle is rotatably connected to the head plate, and is detachably connected to the limit base, and is also connected to the tape head.
19. The system of claim 18, further comprising a magnetic sheet, wherein the magnetic sheet is disposed on one end of the head plate; and the magnetic sheet is configured to magnetically adsorb the head plate on the external fixing part.
20. The system of claim 1, wherein the mounting assembly is connected to the first fixed assembly, and the tape head is connected to the second fixed assembly;
the second fixed assembly comprises a connection base and a connection column; the connection base is fixedly connected to the head plate and is disposed on the head plate; the connection column is connected to the tape head and is detachably connected to the connection base, and is disposed on the connection base.
21. The system of claim 1, wherein the mounting assembly is connected to the first fixed assembly, and the tape head is connected to the second fixed assembly;
the second fixed assembly comprises a magnetic block and a fastener, the magnetic block is connected to the tape head and is connected to the head plate, and is disposed on the tape head; the fastener is fixedly connected to the head plate and is disposed on the head plate....

Claims

What is claimed is:
1. A GLP-1 agonist polypeptide compound, having an amino acid sequence: H Xaa1EGTFTSDVSSYLE Xaa2QAA Xaa3EFIAWLVRGRG (SEQ ID NO: 1), wherein a C-terminal amino acid of the polypeptide compound is a carboxyl or the carboxyl is amidated;
wherein:
Xaa1 is:
Xaa2 is: G,
Xaa1 and Xaa2 are the same or different;
R1 is: a straight-chain or branched-chain alkyl containing 2-6 carbon atoms,
R2 is: H or CH3,
X is: O, S or N—CH3,
R1 is optionally substituted by 1-5 halogen atoms in the case of 2 carbon atoms and 1-6 halogen atoms in the case of 3-6 carbon atoms;
R2 is optionally substituted by 1-3 halogen atoms when R2 is CH3;
Xaa3 is:
n is a natural number ranging from 12 to 20; and
m is a natural number ranging from 0 to 3.
2. The GLP-1 agonist polypeptide compound of claim 1, wherein the amino acid sequence of the polypeptide compound is one of the following sequences:
(1)
NO: 1
HX2EGTFTSDVSSYLEX2QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(2)
NO: 2
HX2EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(3)
NO: 3
HX3EGTFTSDVSSYLEX3QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(4)
NO: 4
HX3EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(5)
NO: 5
HX4EGTFTSDVSSYLEX4QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(6)
NO: 6
HX4EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(7)
NO: 7
HX5EGTFTSDVSSYLEX5QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(8)
NO: 8
HX5EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(9)
NO: 9
HX6EGTFTSDVSSYLEX6QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(10)
NO: 10
HX6EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(11)
NO: 11
HX7EGTFTSDVSSYLEX7QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(12)
NO: 12
HX7EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(13)
NO: 13
HX8EGTFTSDVSSYLEX8QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(14)
NO: 14
HX8EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(15)
NO: 15
HX9EGTFTSDVSSYLEX9QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(16)
NO: 16
HX9EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(17)
NO: 17
HX10EGTFTSDVSSYLEX10QAAK(HOOC-(CH2)16-CO-γ-Glu-
AEEA-AEEA)EFIAWLVRGRG
(18)
NO: 18
HX10EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(19)
NO: 19
HX11EGTFTSDVSSYLEX11QAAK(HOOC-(CH2)16-CO-γ-Glu-
AEEA-AEEA)EFIAWLVRGRG
(20)
NO: 20
HX11EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(21)
NO: 21
HX12EGTFTSDVSSYLEX12QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
(22)
NO: 22
HX12EGTFTSDVSSYLEX1QAAK(HOOC-(CH2)16-CO-γ-Glu-AEEA-
AEEA)EFIAWLVRGRG
wherein:...

Claims

CLAIM
1. The ornamental design for a foldable shoe box as shown and described....

Claims

What is claimed is:
1. A load-aware directory migration method in a distributed file system (DFS), the method comprising:
1) receiving a plurality of directory requests created by DFS clients, parsing each of the plurality of directory requests, to obtain directory request information corresponding to the plurality of directory requests;
2) inputting all of the directory request information corresponding to the plurality of directory requests obtained in 1) into a pre-trained machine learning model, to obtain directory labels corresponding to all directory requests;
3) obtaining a label corresponding to a maximum score interval from the directory labels corresponding to all directory requests obtained in 2), and obtaining all directories in the directory request information corresponding to the label;
4) Building a directory migration queue based on all the directories obtained in 3); and
5) Migrating all the directories in the directory migration queue obtained in 4) through particle swarm optimization (PSO);
wherein:
in 1), parsing each of the plurality of directory requests to obtain directory request information corresponding to the plurality of directory requests comprises: obtaining a first historical information dataset comprising I/O history records during DFS runtime based on the directory requests, preprocessing the first historical information dataset to remove features unrelated to the directory requests, to obtain a second historical information dataset that only contains features related to the directory requests; and parsing the second historical information dataset, to obtain the directory request information corresponding to the plurality of directory requests;
the machine learning model is a lightweight gradient boosting machine (LightGBM) model; and
the machine learning model is trained through the following steps:
2.1) collecting historical directory data for all storage nodes in DFS;
2.2) for the historical directory data of each storage node in DFS collected in 2.1), obtaining the directory request information corresponding to each directory;
2.3) for the historical directory data of each storage node in DFS collected in 2.1), processing the historical directory data to obtain directory status information corresponding to each directory;
2.4) for the historical directory data of each storage node in DFS collected in 2.1), normalizing the directory request information corresponding to all directories obtained in 2.2) to obtain normalized directory request information corresponding to each storage node; dividing the directory request information corresponding to all storage nodes and normalized directories into a training set and a testing set in a ratio of 6:4;
2.5) for each directory request information in the training set obtained in 2.4), calculating a directory hotness score corresponding to the directory request information;
2.6) obtaining minimum and maximum values of the directory hotness score corresponding to the directory request information in the training set obtained in 2.5), and dividing all directory hotness scores into K score intervals based on the maximum and minimum values, with each score interval corresponding to a label;
2.7) inputting K labels obtained in 2.6) and the directory request information corresponding to each directory in the historical directory data of each storage node in DFS obtained in 2.2) into the machine learning model for classification training, to obtain a preliminarily trained machine learning model; and
2.8) testing the preliminarily trained machine learning model obtained in 2.7) with the testing set obtained in 2.4), to obtain a trained machine learning model.
2. The method of claim 1, wherein the historical directory data of an i-th storage node in DFS comprises a current value Rc (i, r) of a resource dimension r at a current time of the i-th storage node in DFS and a maximum value Rt (i, r) of the resource dimension r of the i-th storage node in DFS, where r represents one of two resource dimensions of input/output operations per second (IOPS) and bandwidth, i represents the i-th storage node in DFS, and i∈(1, a total number of storage nodes in DFS is m), υ represents an average resource utilization of all storage nodes in DFS, and
υ
=
1
m
⁢
∑
i
=
1
m
⁢
R
c
(
i
,
r
)
R
t
(
i
,
r
)
;
in 2.3), an average IOPS and average bandwidth of each directory in the historical directory data of each storage node in DFS collected in 2.1) are calculated in sequence and used as the directory request information corresponding to the directory.
3. The method of claim 2, wherein in 2.5), the directory hotness score corresponding to the directory request information is calculated as follows:
HotnessScore
=
λ
×
F
+
1
-
λ
Δ
⁢
T
,
λ
∈
[
0
,
1
]
;
λ refers to a learned factor; F refers to access frequency to the directory, and ΔT refers to a mean value of the time intervals between every two access in a time window;
in 2.6), K is from 0 to 4, and each directory request information in the training set corresponds to K labels based on the score interval of the corresponding directory hotness score.
4. The method of claim 3, wherein in 4), building a directory migration queue based on all the directories comprises:
4.1) initializing a total capacity of directories included in the directory migration queue: Capacity=0;
4.2) determining whether the total capacity of the directory included in the directory migration queue is greater than or equal to a predetermined proportion of a storage node capacity in DFS; if so, ending step of 4.2), otherwise, proceeding to 4.3);
4.3) obtaining a current balance of DFS and determining if the current balance is greater than or equal to a preset threshold; if so, ending step of 4.3), otherwise, proceeding to 4.4);
4.4) adding all the directories obtained in 3) to the directory migration queue which is initially empty to obtain an updated directory migration queue;
4.5) performing statistical analysis on the updated directory migration queue in 4.4) to obtain status information of each directory in peer directories in the updated directory migration queue;
4.6) for each directory in the updated directory migration queue obtained in 4.4), obtaining an optimal adjustment factor α of the directory based on the status information of the directory in the peer directories in the updated directory migration queue obtained in 4.5);
4.7) for each directory in the updated directory migration queue obtained in 4.4), selecting α peer directories of the directory based on the optimal adjustment factor α of the directory obtained in 4.6), and determining if there is a correlation between the α peer directories; if so, proceeding directly to 4.8), otherwise setting α=0 and proceeding to 4.8);
4.8) for each directory in the updated directory migration queue obtained in 4.4), packaging the α peer directories of the directory into one object, and placing the object in the updated directory migration queue obtained in 4.4), to obtain a final directory migration queue; and
4.9) calculating a current capacity CapacityDirj of a j-th directory in the final directory migration queue, where j∈(1, a total number of directories in the final directory migration queue is num), setting a total directory capacity contained in the final directory migration queue to Capacity=Capacity+Capacity_Dir1+Capacity_Dir2+ . . . +Capacity Dirnum, and returning to 4.2).
5. The method of claim 4, wherein the current balance of DFS is calculated as follows:
Balance
=
υ
{
1
m
⁢
∑
i
=
1
m
⁢
(
R
c
(
i
,
r
)
R
t
(
i
,
r
)
-
υ
)
2
}
.
6. The method of claim 5, wherein in 4.6), the optimal adjustment factor α of the directory is obtained as follows: obtaining the IOPS of each directory in the updated directory migration queue, obtaining a first directory in the updated directory migration queue, and fitting multiple peer directories for the first directory to yield an IOPS curve; obtaining a directory number corresponding to a maximum slope change in the IOPS curve; defining a total number of directories in a horizontal axis of the IOPS curve before the directory number as the optimal adjustment factor α for the directory; for all remaining directories in the updated directory migration queue, repeating the above operations until all directories have been processed....

Claims

What is claimed is:
1. A method for preparing a poly(thioctic acid)-copper coating (poly(TA-Cu)) on a surface of a cardiovascular stent material, comprising:
grinding a cardiovascular stent material with sandpaper until a surface of the cardiovascular stent material is flat and smooth, rinsing the cardiovascular stent material with deionized water and anhydrous ethanol in sequence, and drying the cardiovascular stent material to obtain a pre-treated cardiovascular stent material;
dissolving thioctic acid in an alcoholic solvent, adding anhydrous copper chloride to a mixed solution of thioctic acid and the alcoholic solvent, stirring the mixed solution, to yield a precursor solution; treating the pre-treated cardiovascular stent material with the precursor solution, and drying, thus forming a poly(thioctic acid)-copper coating on the surface of the pre-treated cardiovascular stent material;
wherein:
a concentration of thioctic acid in the alcoholic solvent is 0.1-0.3 g/mL, and a molar ratio of anhydrous copper chloride to thioctic acid monomer is between 1:100 and 1:5000.
2. The method of claim 1, wherein the cardiovascular stent material is magnesium alloy, zinc alloy, iron alloy, 316L stainless steel, nickel titanium alloy, cobalt chromium alloy, or polylactic acid.
3. The method of claim 1, wherein the alcoholic solvent is anhydrous methanol or anhydrous ethanol.
4. The method of claim 1, wherein the cardiovascular stent material is treated with the precursor solution through dip coating, spin coating, or spray coating, to form the poly(thioctic acid)-copper coating on the surface of the pre-treated cardiovascular stent material.
5. The method of claim 1, further comprising disposing a magnesium fluoride conversion layer on the pre-treated cardiovascular stent material, which comprises submerging the pre-treated cardiovascular stent material into a hydrofluoric acid solution for 40-50 hours at 20-40° C., cleaning and drying a resulting product, to achieve the magnesium fluoride conversion layer on the pre-treated cardiovascular stent material; wherein the hydrofluoric acid solution has a concentration of 35-40 wt. %, and the poly(thioctic acid)-copper coating is formed on the magnesium fluoride conversion layer....

Claims

CLAIM
1. The ornamental design for a storage box as shown and described....

Claims

What is claimed is:
1. An air gun, comprising:
a cylinder;
a cartridge;
an air valve; and
a stop piece;
wherein:
the air valve comprises an assembly channel, a communication port, and an air passage connected to the assembly channel through the communication port;
the cartridge is disposed in the assembly channel and comprises an ejection channel communicating with the air passage through the communication port;
the stop piece is disposed on the air valve to push the cartridge towards the communication port, thereby locking the cartridge onto the air valve, and fitting the cartridge and the air valve at least at an outer circumference of the communication port; and
the cartridge comprises a first pin movable along the ejection channel to open and close the communication port.
2. The air gun of claim 1, wherein the cartridge is provided with two first seal rings; the two first seal rings are disposed on opposite sides of the communication port, and against an outer wall of the cartridge and an inner wall of the assembly channel, respectively.
3. The air gun of claim 2, wherein the outer wall of the cartridge comprises two seal grooves for receiving the two first seal rings, respectively; and the two first seal rings are embedded in corresponding seal grooves through interference fit.
4. The air gun of claim 1, wherein an outer wall of the cartridge comprises a locating groove, and the stop piece extends into the locating groove.
5. The air gun of claim 4, wherein a depth of the locating groove accounts for a quarter or one third of a wall thickness of the cartridge; and/or, one end of the stop piece against the cartridge is tapered, and a shape of the locating groove is corresponding to the one end of the stop piece against the cartridge.
6. The air gun of claim 5, wherein the air valve comprises a connection channel for the stop piece to extend into the assembly channel, and the stop piece comprises a threaded part in threaded connected to the connection channel and a butting part connected to the threaded part to push against the cartridge.
7. The air gun of claim 6, wherein the air valve comprises a connecting column extending radially outward from an outer wall of the air valve, and the connection channel is formed in the connecting column.
8. The air gun of claim 6, wherein the connection channel communicates with outside, and an axial length of the connection channel is not less than an axial length of the stop piece.
9. The air gun of claim 4, wherein the air valve comprises a connection channel for the stop piece to extend into the assembly channel, and the stop piece comprises a threaded part in threaded connected to the connection channel and a butting part connected to the threaded part to push against the cartridge.
10. The air gun of claim 9, wherein the air valve comprises a connecting column extending radially outward from an outer wall of the air valve, and the connection channel is formed in the connecting column.
11. The air gun of claim 9, wherein the connection channel communicates with outside, and an axial length of the connection channel is not less than an axial length of the stop piece.
12. The air gun of claim 1, wherein the air valve comprises a connection channel for the stop piece to extend into the assembly channel, and the stop piece comprises a threaded part in threaded connected to the connection channel and a butting part connected to the threaded part to push against the cartridge.
13. The air gun of claim 12, wherein the air valve comprises a connecting column extending radially outward from an outer wall of the air valve, and the connection channel is formed in the connecting column.
14. The air gun of claim 12, wherein the connection channel communicates with outside, and an axial length of the connection channel is not less than an axial length of the stop piece.
15. The air gun of claim 1, wherein a second seal ring is disposed on the ejection channel, and butts against an outer wall of the first pin and an inner wall of the ejection channel; and the cylinder comprises an inlet channel; the inlet channel communicates with the air passage through an intake port, and the air valve comprises a second pin capable of moving along the air passage to open and close the intake port.
16. The air gun of claim 15, wherein the air valve is an integrally-formed structure and comprises a first connector connected to the cylinder and a second connector connected to the cartridge; the first connector is partially disposed in the inlet channel and the air passage is disposed in the first connector; the second connector is disposed on the first connector and the assembly channel is disposed in the second connector; and the cartridge is disposed through the assembly channel of the second connector....

Claims

What is claimed is:
1. A method for preparing a curved blade of a centrifugal impeller, the centrifugal impeller comprising a disk and a cover, wherein the centrifugal impeller is centered around a rotating axis, the disk comprises a disk surface perpendicular to the rotating axis, and the cover comprises a cover surface perpendicular to the rotating axis; the method comprising:
S1) providing a primary blade, wherein the primary blade comprises an inlet edge, an outlet edge, a blade root, and a blade top; the inlet edge is disposed oppositely to the outlet edge; the blade root is disposed oppositely to the blade top; the blade root is adapted to be disposed along and connected to the disk surface, the blade top is adapted to disposed along and connected to the cover surface; the inlet edge and the outlet edge are disposed between the blade root and the blade top; the inlet edge is adapted to be disposed adjacent to the rotating axis with respect to the outlet edge; and a vertex is defined at a joint of the outlet edge and the blade top;
S2) forming a fold line on the primary blade, wherein the fold line comprises a first point and a second point; the first point is defined on the outlet edge; the second point is defined on the blade top; a first curve is formed on the outlet edge between the first point and the vertex; a second curve is formed on the blade top between the second point and the vertex; the first curve, the second curve, and the fold line enclose a bending region; and
S3) bending the bending region along the fold line towards the rotating axis to form the curved blade, while moving the second curve of the bending region along the cover surface.
2. The method of claim 1, wherein in S2), forming a fold line on the primary blade comprises:
S2-1) defining the first point; obtaining a camber line through the first point; drawing a first line segment on a tangent of the camber line passing through at the first point; rotating the first line segment about the first point within a normal plane of the first curve towards the rotating axis by a first angle to obtain a second line segment, wherein an endpoint of the first line segment is on one side of the first point away from the inlet edge;
S2-2) moving the second line segment from the first point to the vertex, thereby generating a profile; and
S2-3) rotating the profile about the second line segment towards the rotating axis by a second angle to intersect with the primary blade to form an intersection curve, referred to as the fold line.
3. The method of claim 2, wherein the first angle is between 3° and 10°.
4. The method of claim 2, wherein the second angle is between 3° and 6°.
5. The method of claim 1, wherein a length of the first curve is less than or equal to half a length of the outlet edge.
6. The method of claim 2, wherein in S3), the bending region is bent along the fold line towards the rotating axis, so as to coincide with the profile, thereby obtaining the curved blade.
7. The method of claim 1, wherein the fold line and the outlet edge are intersected with a plurality of camber lines, forming a plurality of curves; and lengths of the plurality of curves increase from the first point to the vertex.
8. The method of claim 7, wherein the primary blade is prepared by sheet metal stamping.
9. A curved blade, prepared according to the method of claim 1.
10. A centrifugal impeller, comprising a disk, a cover, and a plurality of the curved blades of claim 9, wherein the plurality of the curved blades is disposed between the disk and the cover; the disk is connected to the blade root of each of the plurality of the curved blades; and the cover is connected to the blade top of each of the plurality of the curved blades....

Claims

The invention claimed is:
1. A method for selective oxidation of macromolecular organic pollutants using free radicals produced in a heterogeneous Fenton reaction, the method comprising:
1) assembling a device, the device comprising a heterogeneous Fenton reaction unit and an electrochemical cell; the heterogeneous Fenton reaction unit comprising a reactor and an anion exchange membrane disposed in the reactor to separate the reactor into a first chamber and a second chamber; filling the first chamber with a catalyst; and filling the second chamber with a dielectric material;
2) providing wastewater containing hydrogen peroxide and hydroxylamine hydrochloride; and measuring an original pH of the wastewater; and
3) introducing the wastewater into the first chamber; connecting a power supply to the heterogeneous Fenton reaction unit; turning on the power supply, an electric field with an initial voltage is formed in the reactor, and organic acids generated by a heterogeneous Fenton solution in the reactor move from the first chamber into the second chamber.
2. The method of claim 1, wherein 3) further comprises monitoring a real-time pH of the wastewater in the first chamber and regulating the real-time pH of the wastewater by changing a voltage of the electric field.
3. The method of claim 1, wherein:
in 1), a water circulator is connected to the heterogeneous Fenton reaction unit;
in 2), the original pH of the wastewater is 3-6;
in 3), when the water circulator is turned on, the wastewater flows through the water circulator and the first chamber successively to form a fixed bed, and the heterogeneous Fenton reaction happens in the first chamber; when the power supply is turned on, an electric field with an initial voltage is formed in the reactor; the pH of the wastewater in the first chamber is monitored; when the pH exceeds the original pH, the voltage is regulated until the pH approaches to the original pH; and then the voltage returns to its initial value.
4. The method of claim 3, wherein an anode and a cathode are electrically connected to the power supply; the cathode is disposed in the first chamber; the anode is disposed in the second chamber; a distance between the cathode and the anode is less than or equal to 5 cm; and a maximum voltage of the eclectic field is less than or equal to 3 V.
5. The method of claim 4, wherein when the pH of the wastewater in the first chamber decreases by 1-2 compared to the original pH, the voltage of the electric field is increased by 0.1-0.2 V.
6. The method of claim 5, wherein the water circulator is a peristaltic pump;
when the initial voltage is 0.5-1 V, the peristaltic pump works at 50-100 rpm;
when the initial voltage is 1-2 V, the peristaltic pump works at 100-150 rpm; and
when the initial voltage is 2-3 V, the peristaltic pump works at 150-200 rpm.
7. The method of claim 1, wherein the wastewater comprises macromolecular organic pollutants which are degraded into low-molecular-weight organic acids through the heterogeneous Fenton reaction in the reactor....

Claims

What is claimed is:
1. A method for controlling an amount of a liquid carbon source released to a constructed wetland for treatment of polluted water using a system, the system comprising:
a carbon source pool, a carbon source pipe, a peristaltic pump, a programmable logic controller (PLC), a computer, a first flow meter, a first chemical oxygen demand (COD) sensor, a first total nitrogen (TN) sensor, a second TN sensor, a second COD sensor, an inlet pipe, and an outlet pipe; wherein:
the first flow meter, the first COD sensor, and the TN sensor are disposed on the inlet pipe; the second COD sensor and the second TN sensor are disposed on the outlet pipe; the inlet pipe and the outlet pipe are connected to the constructed wetland; the carbon source pipe is connected to the carbon source pool via the peristaltic pump; the computer, the peristaltic pump, the first flow meter, and all sensors are connected to the PLC; and
the first flow meter is configured to measure a flow of an influent to the constructed wetland; the first COD sensor is configured to monitor a concentration of COD in the influent (CODin); the first TN sensor is configured to monitor a concentration of TN in the influent (TNin); the second TN sensor is configured to monitor a concentration of TN in an effluent from the constructed wetland (TNout); and the second COD sensor is configured to monitor a concentration of COD in the effluent (CODout);
the method comprising:
S1. disposing the carbon source pipe in a water distribution channel in the constructed wetland;
S2. gathering aquatic plant straws from the constructed wetland; grinding the aquatic plant straws into powders; and soaking the powders in the carbon source pool; passing a resulting mixture through a filter so that the liquid carbon source is separated from carbon residues;
S3. receiving, by the PLC, data from the first flow meter, the first COD sensor, the first TN sensor, the second TN sensor, and the second COD sensor; and sending the data to the computer to calculate a preset volume (V) of the liquid carbon source to be released to the constructed wetland;
S4. calculating the preset volume (V) of the liquid carbon source released to the constructed wetland according to following formula:
V=(Q*(5*(TNin−TNout)−(CODin−CODout))/COD equivalent of carbon source from plant)/ρ;
wherein:
V is a volume of the liquid carbon source;
Q is a volume flow rate of the influent flowing into the constructed wetland (unit: m3/d);
ρ is a density of the liquid carbon source (unit: 1.0 g/mL);
when the influent has a ratio of CODin to TNin of greater than 6, the carbon source is not an impact factor hindering denitrification in the constructed wetland, and thus the liquid carbon source is not released; and
S5. sending the preset volume to the PLC; and controlling, by the PLC, operations of the peristaltic pump and a regulating valve connected to the peristaltic pump, so that the preset volume (V) of the liquid carbon source is added to the constructed wetland via the carbon source pipe; and monitoring, by a second flow meter disposed on the carbon source pipe and connected to the PLC, the flow of the liquid carbon source released to the constructed wetland.
2. The method of claim 1, wherein the computer acquires the data from an online monitoring device that monitors the flow, TNin, and CODin in real time....

Claims

What is claimed is:
1. A modified DNA polymerase, comprising a DNA polymerase fragment that maintains the DNA polymerase activity and a G-quadruplex binding peptide fused to the N-terminal of the DNA polymerase fragment.
2. The modified DNA polymerase of claim 1, wherein the G-quadruplex binding peptide comprises a RHAU23 peptide shown in SEQ ID NO: 1; or, the G-quadruplex binding peptide comprises a G4P peptide shown in SEQ ID NO: 2.
3. The modified DNA polymerase of claim 2, wherein the DNA polymerase fragment is resistant to temperatures above 40° C. and has activity at temperatures above 40° C.
4. The modified DNA polymerase of claim 3, wherein the DNA polymerase fragment is derived from any one of Bst DNA polymerase, Taq DNA polymerase and MMLV reverse transcriptase.
5. The modified DNA polymerase of claim 4, wherein the DNA polymerase fragment is derived from Bst DNA polymerase, and comprises an amino acid sequence shown in SEQ ID NO: 3.
6. The modified DNA polymerase of claim 4, wherein the DNA polymerase fragment is derived from Taq DNA polymerase, and comprises an amino acid sequence shown in SEQ ID NO: 4.
7. The modified DNA polymerase of claim 4, wherein the DNA polymerase fragment is derived from MMLV reverse transcriptase, and comprises an amino acid sequence shown in SEQ ID NO: 5.
8. A warm-start DNA polymerase, comprising the modified DNA polymerase of claim 1 and an aptamer comprising a G-quadruplex sequence; wherein the G-quadruplex of the aptamer binds to the G-quadruplex binding peptide of the modified DNA polymerase at a first preset temperature to inhibit the activity of the DNA polymerase, and detaches from the G-quadruplex binding peptide of the modified DNA polymerase at a second preset temperature to restore the activity of the DNA polymerase; and the second preset temperature is higher than the first preset temperature.
9. The warm-start DNA polymerase of claim 8, wherein the first preset temperature is 0° C.-30° C., and the second preset temperature is 45° C.-70° C.
10. A kit, comprising the warm-start DNA polymerase of claim 8.
11. The kit of claim 10, wherein the kit is used to detect human papilloma virus DNA or SARS virus RNA.
12. A method for biosynthesizing the modified DNA polymerase of claim 1, comprising:
inserting a nucleotide sequence encoding the DNA polymerase fragment into a plasmid vector to construct a first plasmid;
inserting a nucleotide sequence encoding the G-quadruplex binding peptide into the first plasmid 5′ to the nucleotide sequence encoding the DNA polymerase fragment so that the two nucleotide sequences are fused in frame, to construct a second plasmid;
transforming the second plasmid into an E. coli strain for culturing and inducing expression of a protein; and
purifying the protein to obtain the modified DNA polymerase.
13. The method of claim 12, wherein the DNA polymerase fragment is derived from residues 291-878 of DNA polymerase of Bacillus stearothermophilus, the plasmid vector is pCold-I, and the first plasmid is pCold-I-Bst-LF plasmid; the G-quadruplex binding peptide is G4P, and the second plasmid is pCold-I-G4P-Bst plasmid; or, the G-quadruplex binding peptide is RHAU23, and the second plasmid is pCold-I-RHAU23-Bst plasmid.
14. The method of claim 12, wherein the DNA polymerase fragment is derived from Taq DNA polymerase, the plasmid vector is pCold-I, and the first plasmid is pCold-I-Taq plasmid; the G-quadruplex binding peptide is G4P, and the second plasmid is pCold-I-G4P-Taq plasmid; or, the G-quadruplex binding peptide is RHAU23, and the second plasmid is pCold-I-RHAU23-Taq plasmid.
15. The method of claim 12, wherein the DNA polymerase fragment is derived from MMLV reverse transcriptase, the plasmid vector is pCold-I, and the first plasmid is pCold-I-RT plasmid; the G-quadruplex binding peptide is G4P, and the second plasmid is pCold-I-G4P-RT plasmid; or, the G-quadruplex binding peptide is RHAU23, and the second plasmid is pCold-I-RHAU23-RT plasmid.
16. A method for preparing the warm-start DNA polymerase of claim 8, the method comprising:
dissolving the aptamer in a first buffer, denaturing at 90° C.-100° C. for 2 min to 8 min, cooling to 20° C.-30° C. to obtain a treated aptamer; and
adding the modified DNA polymerase and the treated aptamer to a second buffer at a preset molar concentration ratio, and incubating at 2° C.-6° C. for 30 min to 60 min;
optionally wherein:
the first buffer comprises 10 mM Tris-HCl (pH 7.4), 75 mM KCl, 0.5 mM EDTA and 0.2 mg/ml bovine serum albumin, and the second buffer comprises 20 mM Tris-HCl (pH 8.8), 10 mM (NH4) 2SO4, 50 mM KCl, 2-8 mM MgSO4, and 0.10% Tween-20.
17. The method of claim 16, wherein the preset molar concentration ratio of the modified DNA polymerase to the aptamer is between 1:8 and 1:1.
18. A method for detecting or synthesizing a nucleic acid comprising contacting the warm-start DNA polymerase of claim 8 with reagents required for detecting or synthesizing of the nucleic acid.
19. The method of claim 18, wherein the nucleic acid is a human papilloma virus DNA or SARS-COV-2 virus RNA....

Claims

What is claimed is:
1. A disc motor, comprising:
a stator assembly; and
a rotor assembly, the rotor assembly comprising a rotor core, a first set of magnetic tiles, and a second set of magnetic tiles;
wherein:
the stator assembly is coupled to the rotor assembly through an axial magnetic field;
the first set of magnetic tiles is disposed on the rotor core along a first circumference and magnetized;
the second set of magnetic tiles is disposed on the rotor core along a second circumference and magnetized tangentially;
the first set of magnetic tiles is disposed near the stator assembly, and the second set of magnetic tiles is disposed away from the stator assembly;
the first set of magnetic tiles is axially staggered with the second set of magnetic tiles at a distance of L3;
the first set of magnetic tiles comprises N first magnetic tiles disposed uniformly along the first circumference, and the second set of magnetic tiles comprises N second magnetic tiles disposed uniformly along the second circumference, where N is an integer;
a first centerline L1 is formed between every two adjacent first magnetic tiles, and each second magnetic tile comprises a second centerline L2; the first centerline L1 is offset from the second centerline L2 in a circumferential direction, which reduces an electrical angle difference between a first current angle corresponding to a maximum permanent magnet torque and a second current angle corresponding to a maximum reluctance torque, thereby increasing a maximum output torque of the disc motor;
the first centerline L1 is offset from the second centerline L2 in the circumferential direction by an offset angle α;
each first magnetic tile has a cross section in the shape of a sector, and each second magnetic tile has a square cross section;
the rotor core comprises a first annular end plate, a second annular end plate, a plurality of iron block portions, and a plurality of connecting portions; the plurality of connecting portions is evenly disposed along a circumference between the first annular end plate and the second annular end plate to connect the first annular end plate and the second annular end plate together; a first mounting slot is formed between every two adjacent connecting portions; each first magnetic tile is inserted into a corresponding first mounting slot; and
the plurality of the iron block portions are uniformly disposed and protrudes along the circumference from a bottom part of the second annular end plate; a second mounting slot is formed between every two adjacent iron block portions; and each second magnetic tile is inserted into a corresponding second mounting slot.
2. The disc motor of claim 1, wherein a first air-gap magnetic barrier is formed between each of two sides of the first magnetic tile and an adjacent connecting portion; and a second air-gap magnetic barrier is formed between each of the first magnetic tiles and a top of the second mounting slot.
3. The disc motor of claim 2, wherein each of the connecting portions comprises a through hole extending radially along the rotor core; and the through hole functions as a third air-gap magnetic barrier.
4. The disc motor of claim 3, wherein the first set of magnetic tiles comprises eight first magnetic tiles evenly disposed along the first circumference, and the second set of magnetic tiles comprises eight second magnetic tiles evenly disposed along the second circumference.
5. The disc motor of claim 4, wherein the offset angle α ranges between 6°-7°; and the electrical angle difference between the first current angle corresponding to the maximum permanent magnet torque and the second current angle corresponding to the maximum reluctance torque is between 7.5°-12.5°....

Claims

The invention claimed is:
1. A base material, comprising: a first structural layer, a second structural layer located at least on one surface of the first structural layer; the second structural layer comprising:
a) a first protrusion portion, wherein the first protrusion portion extends along one length direction of the second structural layer;
b) a first concave portion that extends substantially in the same direction as the first protrusion portion and is adjacent to the first protrusion portion; and
c) a plurality of holes distributed in the first protrusion portion;
at least 0.05% of the holes communicate with adjacent first concave portions; and
the first structural layer comprises at least one transition metal at a content of at least 90%, and the second structural layer comprises an oxide of the transition metal at a content of at least 30%.
2. The base material of claim 1, wherein the base material is flexible in at least one direction; the base material has a bending angle of not less than 90°; and the base material has a bulk density not higher than 1 g/cm3.
3. The base material of claim 1, wherein the base material is prepared by using transition metal flakes as raw materials;
a plurality of concave and convex stripes with a substantially uniform direction is disposed on the transition metal flakes, and cross-sections of the concave and convex stripes have a mesoscopic scale; and
a transition metal oxide film is formed on surfaces of the transition metal flakes, and has a hole array consistent with a direction of the concave and convex stripes; and the holes have an aperture of mesoscopic scale or an aperture of nanometer and/or micron scale.
4. The base material of claim 3, wherein
the transition metal oxide film and the hole array thereon is formed by performing anodizing treatment on the transition metal flakes; and
the second structural layer is formed by performing an etching treatment on the transition metal oxide film and the hole array thereon....

Claims

What is claimed is:
1. A loading/unloading system for a container terminal, the system comprising: a plurality of shore cranes, an operation lane area between two rails of the shore cranes, an automatic container yard area, an operation area from a rear side of a landside rail of the shore cranes to the automatic container yard area, and facilities behind the automatic container yard area;
wherein:
the operation lane area between two rails of the shore cranes comprises a lambdoidal reverse operation area of inner container trucks, a ship lofting operation area, and a loading/unloading operation area of the inner container trucks, which are physically isolated by fences;
the operation area from the rear side of the landside rail of the shore cranes to the automatic container yard area comprises a hatch cover area, an unlocking and locking area of the inner container trucks, an unlocking and locking buffer area, a passing area of the inner container trucks and a charging area of the inner container trucks, which are not physically isolated, thereby facilitating cooperation among the areas in operation;
the automatic container yard area comprises yards and a plurality of automatic rail-mounted gantry cranes disposed in parallel to the yards;
the facilities behind the automatic container yard area comprise intelligent arrival and departure gates, an in-yard parking lot and an auxiliary building area; and
the container terminal is arranged in a quay layout.
2. The system of claim 1, wherein the ship lofting operation area and the loading/unloading operation area of the inner container trucks are independent and are isolated by the fences.
3. The system of claim 1, wherein the hatch cover area is used to stack hatchway covers of ships, or used as a parking area of the inner container trucks without operation.
4. The system of claim 1, wherein the lambdoidal reverse operation area of the inner container trucks is for realizing reverse operation of the containers.
5. A loading/unloading method for the container terminal using the system of claim 1, the method comprising:
S1: shipping and unshipping operation: during unshipping, unloading containers from a container ship by utilizing the plurality of shore cranes, transferring the containers to target operation positions of the yards, then hoisting, by the automatic rail-mounted gantry cranes, the containers to appointed locations, and allowing the inner container trucks to continuously enter a next operation cycle, where containers carrying hazardous goods are transferred by shore crane trolleys to the outer container trucks waiting in the ship lofting operation area and are directly transported out of the terminal area by the outer container trucks along a regulated route; and during unshipping, carrying out reverse operations as that during unshipping; and
S2: container collecting and dispatching operations: in a collecting process, allowing the outer container trucks to drive from arrival and departure gates and a parking lot and further to enter appointed positions of the operation area of the yards, hoisting, by the automatic rail-mounted gantry cranes, the containers to appointed locations, and allowing the outer container trucks unloading the containers to continuously leave a harbor district; and during container dispatching, carrying out reverse operations as that during container collecting....

Claims

What is claimed is:
1. A telescopic stool, comprising:
a first connection ring;
a second connection ring;
a plurality of clamping seats;
a plurality of anti-deformation members; and
a plurality of tightening members;
wherein:
the second connection ring is disposed on an upper part of an inner side of the first connection ring;
the plurality of clamping seats are equidistantly disposed on a lower part of an inner side of the second connection ring;
the plurality of anti-deformation members is clamped on the plurality of clamping seats, respectively;
the plurality of tightening members is disposed on the plurality of clamping seats, respectively;
each of the plurality of anti-deformation members comprises an active connection seat, a fixed block, a first active clamping block, an active connection rod, a second active clamping block, a support block, an elastic spring, and a fixed support rod;
the active connection seat is clamped on the plurality of clamping seats;
the fixed block is fixed on one end of the active connection seat;
the first active clamping block is rotatably connected to the fixed block;
the first active clamping block is fixedly connected to one end of the active connection rod, and the other end of the active connection rod is fixedly connected to the second active clamping block; the second active clamping block is rotatably connected to the support block; each support block is fixedly connected to two fixed support rods, and each fixed support rod is disposed through the upper part of the first connection ring.
2. The telescopic stool of claim 1, wherein two adjacent ends of two adjacent second active clamping blocks are fixedly connected to two ends of the elastic spring, respectively; bottom ends of two adjacent first active clamping blocks are fixedly connected to two ends of an elastic rope.
3. The telescopic stool of claim 1, wherein the plurality of tightening members each comprise a connection seat, an L-shaped clamp rod, a threaded connecting rod, and a threaded fastening cap; the connection seat is disposed on the active connection seat and is located at an outer bottom of the second connection ring; the L-shaped clamp rod is disposed on two top sides of the connection seat; the threaded connecting rod is fixedly connected to a front end to the L-shaped clamp rod; and the threaded connecting rod is disposed through the upper part of the first connection ring and in threaded connection to the threaded fastening cap.
4. The telescopic stool of claim 1, wherein two press blocks are fixedly connected to two sides of a front end of the fixed support rod, respectively, and the two press blocks are disposed on the upper part of the first connection ring in the vicinity of the fixed support rod; and the two press blocks and the first connection ring are detachably connected to fourth anchor bolts.
5. The telescopic stool of claim 1, wherein the active connection seat is detachably connected to each of the plurality of clamping seats through a first anchor bolt.
6. The telescopic stool of claim 1, wherein the first active clamping block is detachably connected to the fixed block through a second anchor bolt.
7. The telescopic stool of claim 1, wherein the second active clamping block is detachably connected to the support block through a third anchor bolt....

Claims

What is claimed is:
1. A folding table, comprising:
a table top comprising a bottom;
a plurality of table legs hinged to the table top;
a plurality of folding stools detachably fixed to the bottom of the table top; and
a plurality of folding support bars disposed between the table top and the table legs;
wherein:
the folding support bars comprise first support bars pivotally connected to the table legs and second support bars pivotally connected to the table top;
the first support bars are hinged to the second support bars; a clamping part is disposed between each first support bar and each second support bar to position the first support bar and the second support bar when the folding table is in an unfolding state; and
the plurality of table legs comprise a first pair of table legs and a second pair of table legs; the first pair of table legs each comprise an arc-shaped part, and in a folding state, the first pair of table legs and the second pair of table legs are overlapped on the bottom of the table top, and the first pair of table legs are covered by the second pair of table legs.
2. The folding table of claim 1, further comprising a connection board disposed on the bottom of the table top, and the plurality of table legs being hinged to the connection board.
3. The folding table of claim 1, wherein a first fixed rod is disposed between the first pair of table legs, and a second fixed rod is disposed between the second pair of table legs.
4. The folding table of claim 3, wherein the first fixed rod is disposed on an inner side of the first pair of table legs, and the second fixed rod is disposed on an outer side of the second pair of table legs.
5. The folding table of claim 3, wherein both the first fixed rod and the second fixed rod comprise a cushion block; and when the folding table is in a folding state, the cushion block is in contact with the folding stools.
6. The folding table of claim 5, wherein the cushion block comprises a head for fixing the folding stools, a tail, and a connection part connecting the head and the tail; the tail is cone-shaped; the connection part comprises an annular groove; the first fixed rod and the second fixed rod comprise a plurality of through holes; the tail is disposed through the through holes, and the connection part is embedded in the through holes of the first fixed rod and the second fixed rod.
7. The folding table of claim 1, wherein both the first pair of table legs and the second pair of table legs comprises fasteners, and when the folding table is in a folding state, the first pair of table legs and the second pair of table legs are locked by the fasteners.
8. The folding table of claim 1, wherein the bottom of the table top comprises a fixed belt; and the fixed belt is an elastic rope configured to fix the folding stools on the bottom.
9. The folding table of claim 1, wherein the clamping part is disposed on the first support bar; the second support bar comprises a recess matched with the clamping part; in an unfolding state, the clamping part is embedded in the recess to limit the rotation of the table legs.
10. The folding table of claim 1, wherein the first support bar comprises a first lower locating hole and a first upper locating hole; the second support bar comprises a second upper locating hole and a second lower locating hole; the second support bar is hinged to the table top through the second upper locating hole; the first support bar is hinged to the table legs through the first lower locating hole; and the first support bar is hinged to the second support bar through the first upper locating hole and the second lower locating hole.
11. The folding table of claim 10, wherein the first support bar further comprises two protrusions disposed equidistantly at two sides of the first upper locating hole; the second support bar comprises a fixing hole; when the folding table is in a folding or unfolding state, one of the two protrusions is limited in the fixing hole.
12. A folding table, comprising:
a table top comprising a bottom;
a plurality of table legs hinged to the table top;
a plurality of folding stools detachably fixed to the bottom of the table top; and
a plurality of folding support bars disposed between the table top and the table legs;
wherein:
the folding support bars comprise first support bars pivotally connected to the table legs and second support bars pivotally connected to the table top;
the first support bars are hinged to the second support bars; a clamping part is disposed between each first support bar and each second support bar to position the first support bar and the second support bar when the folding table is in an unfolding state; and
the bottom of the table top comprises a plurality of grooves and a locating block disposed in each groove; the folding stools are disposed in grooves one by one; and the folding stools each comprise a positioning groove matched with the locating block.
13. The folding table of claim 12, further comprising a connection board disposed on the bottom of the table top, and the plurality of table legs being hinged to the connection board.
14. The folding table of claim 12, wherein the bottom of the table top comprises a fixed belt; and the fixed belt is an elastic rope configured to fix the folding stools on the bottom.
15. The folding table of claim 12, wherein the clamping part is disposed on the first support bar; the second support bar comprises a recess matched with the clamping part; in an unfolding state, the clamping part is embedded in the recess to limit the rotation of the table legs.
16. The folding table of claim 12, wherein the first support bar comprises a first lower locating hole and a first upper locating hole; the second support bar comprises a second upper locating hole and a second lower locating hole; the second support bar is hinged to the table top through the second upper locating hole; the first support bar is hinged to the table legs through the first lower locating hole; and the first support bar is hinged to the second support bar through the first upper locating hole and the second lower locating hole.
17. The folding table of claim 16, wherein the first support bar further comprises two protrusions disposed equidistantly at two sides of the first upper locating hole; the second support bar comprises a fixing hole; when the folding table is in a folding or unfolding state, one of the two protrusions is limited in the fixing hole....

Claims

What is claimed is:
1. An air gun, comprising:
a cartridge comprising a launching chamber;
a cylinder comprising an air chamber;
an air valve;
a first pin; and
a second pin;
wherein:
the air valve is disposed in the air chamber and partially extends out of the cylinder to connect to the cartridge;
the air valve is a single, integrally formed structure and comprises a first connection column, a second connection column, and a connection block; the connection block is connected to the first connection column and the second connection column and is integrally formed with the first connection column and the second connection column; and an air passage comprising an air inlet and an air outlet is disposed within the air valve;
the air passage further comprises a first passage, a second passage, and a third passage; the first passage axially extends within the first connection column; the third passage axially extends within the second connection column; and the second passage extends through the connection block and communicates the first passage with the third passage;
the first connection column is disposed in the air chamber and detachably connected to the cylinder, and the second connection column is detachably connected to the cartridge;
the air inlet is configured to communicate the air chamber with the first connection column;
the air outlet is configured to communicate the launching chamber with the second connection column; and
the first pin is disposed through the first connection column and is movable relative to the cylinder to open and close the air inlet;
the cartridge extends axially into the second connection column from a first opening of the third passage;
the second pin has a solid structure and extends axially into the second connection column from a second opening of the third passage; and
a sliding seat is disposed on the cylinder; the second pin is connected to the sliding seat; the sliding seat is movable between a first position and a second position;
when the sliding seat is in the first position, the second pin is positioned within the launching chamber and closes the air outlet; and when the sliding seat is in the second position, the second pin is retracted from the launching chamber and opens the air outlet.
2. The air gun of claim 1, wherein an outer circumference of the first connection column comprises a plurality of counterbores; the cylinder comprises a plurality of through holes corresponding to the plurality of counterbores one by one; a fastener is disposed in each of the plurality of through holes; and the fastener is configured to fix and position the first connection column on the cylinder.
3. The air gun of claim 2, wherein the first passage is disposed through the first connection column, and a first driving unit and a second driving unit are disposed axially on two ends of the first passage, respectively; the second driving unit is movable along the cylinder between a third position and a fourth position; in the third position, the second driving unit butts against the first pin and the first pin opens the air inlet; in the fourth position, the second driving unit is disconnected with the first pin, and the first pin closes the air inlet.
4. The air gun of claim 3, wherein when the first pin closes the air inlet, one end of the first pin away from the first driving unit extends out of the first connection column; when the second driving unit moves from the fourth position to the third position, the second driving unit drives the first pin to open the air inlet.
5. The air gun of claim 3, wherein the first driving unit comprises a connecting cylinder and a first elastic piece; the connecting cylinder is in threaded connection to the connection column and comprises a first assembly chamber; the first assembly chamber communicates with the first passage and the air chamber; the first elastic piece is disposed in the first assembly chamber and butts against the first pin; the first elastic piece is elastically contractive in a movement direction of the first pin, to drive the first pin to move towards the second driving unit and extend out of the connection column.
6. The air gun of claim 3, wherein the second driving unit comprises a sliding block and a second elastic piece; the sliding block comprises a second assembly chamber; the second assembly chamber is opened on one side of the sliding block away from the first pin, and the second elastic piece is disposed in the second assembly chamber and butts against the cylinder; a trigger is disposed on the cylinder and is rotatable with a joint of the trigger and the cylinder as an axis to engage with or detach from the sliding block; when the trigger detaches from the sliding block, the sliding block is driven by the second elastic piece to butt against the first pin, and the first pin moves to open the air inlet; when the trigger engages with the sliding block, the sliding block detaches from the first pin, and the first pin is driven by the first driving unit to move and close the air inlet.
7. The air gun of claim 2, wherein a sealing sleeve is disposed in the first passage; the sealing sleeve surrounds the first pin and is adjacent to the air inlet; an outer wall of the sealing sleeve comprises an annular groove, and a seal ring is disposed in the annular groove....

Claims

What is claimed is:
1. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
the mechanical driver further comprises a transmission gear coaxially disposed with the rotation disc; the guide disc is meshed with the transmission gear and comprises a plurality of protrusion groups; the plurality of protrusion groups are radially spaced apart on the guide disc; each of the plurality of protrusion groups comprises a plurality of protrusions circumferentially spaced apart on the guide disc; the plurality of protrusions in a first protrusion group are misaligned with the plurality of protrusions in a second protrusion group in a circumferential direction of the guide disc to form a plurality of gaps; the second protrusion group is adjacent to the first protrusion group, and each gap allows a single ammunition round to pass through one time.
2. The mechanical magazine of claim 1, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
3. The mechanical magazine of claim 2, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
4. The mechanical magazine of claim 1, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc.
5. The mechanical magazine of claim 3, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
6. The mechanical magazine of claim 1, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
7. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
the mechanical driver further comprises a transmission gear coaxially disposed with the rotation disc and meshed with the guide disc; an acceleration gear is meshed with the guide disc; the acceleration gear comprises an eccentric wheel; when the energy storage unit releases energy, the eccentric wheel is configured to swing, to speed up the rotation of the rotation disc towards the ammunition outlet.
8. The mechanical magazine of claim 7, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc.
9. The mechanical magazine of claim 7, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
10. The mechanical magazine of claim 9, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
11. The mechanical magazine of claim 10, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
12. The mechanical magazine of claim 7, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
13. A mechanical magazine, comprising:
a casing, the casing comprising an ammunition inlet, an ammunition outlet, and an ammunition passage extending from the ammunition inlet to the ammunition outlet; and
a mechanical driver, the mechanical driver comprising a rotation disc and an energy storage unit;
wherein,
the mechanical driver is disposed on one side of the casing and is configured to drive ammunition rounds to move from the ammunition inlet to the ammunition outlet and to be ejected out of the casing;
the rotation disc is rotationally connected to the casing to push the ammunition rounds to move along the ammunition passage;
the energy storage unit is disposed on the rotation disc, and when the rotation disc rotates relative to the casing, the energy storage unit is subjected to elastic deformation to store or release energy;
when in use, the rotation disc rotates in a direction towards the ammunition inlet, the energy storage unit is compressed to save energy; when the energy is released, the energy storage unit drives the rotation disc to rotate in a direction towards the ammunition outlet, causing the ammunition rounds to move in the direction towards the ammunition outlet and to be ejected out of the casing;
the ammunition passage comprises a multiple-round passage, a single-round passage, and a conversion space connecting the multiple-round passage and the single-round passage; the single-round passage surrounds the rotation disc and extends from the conversion space to the ammunition outlet; and a guide disc is disposed in the multiple-round passage to guide the ammunition rounds in the multiple-round passage to the single-round passage one by one; and
a turntable is disposed on one side of the conversion space facing the rotation disc; and the turntable comprises elastic material.
14. The mechanical magazine of claim 13, wherein a locking mechanism is disposed between the rotation disc and the casing; the locking mechanism is configured to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
15. The mechanical magazine of claim 14, wherein the locking mechanism comprises a limit gear disposed on the rotation disc and a limit arm disposed on the casing; the limit arm is meshed with the limit gear to restrict the rotation disc from rotating in the direction towards the ammunition outlet, whereby the energy storage unit stays in an energy storage state.
16. The mechanical magazine of claim 15, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; a front chamber is formed by the front cover and the partition, and the limit gear is disposed in the front chamber; the limit arm passes through the partition and is connected to the limit gear in the front chamber; the mechanical driver comprises a rotary knob; the rotary knob is disposed on an outer side of the front cover and sequentially extends into the front chamber and the ammunition passage to connect with the limit gear and the rotation disc.
17. The mechanical magazine of claim 13, wherein a stop block is disposed on one side of the ammunition outlet of the casing; the stop block is movable relative to the casing to open and close the ammunition outlet; the casing further comprises a groove and the stop block is disposed in the groove; a spring is disposed in the groove to drive the stop block to move and close the ammunition outlet; and one side of the stop block facing away from the ammunition outlet is an inclined plane.
18. The mechanical magazine of claim 13, wherein the casing comprises a front cover, a partition, and a rear cover; the ammunition passage is formed by the partition and the rear cover; the rear cover comprises an accommodating ring, and the transmission gear and the guide disc are disposed in the accommodating ring; a guide member is disposed in the multiple-round passage and extends to the accommodating ring; and the guide member is configured to guide the ammunition rounds to the guide disc....

Claims

What is claimed is:
1. A method for extending shelf life of germ-remained rice, the method comprising:
1) evenly spreading the germ-remained rice on a sheet tray, and moderately moistening the germ-remained rice; and
2) packing the germ-remained moistened rice, and irradiating the germ-remained rice with an electron beam; and
wherein moderately moistening comprises transferring the sheet tray to a constant climate chamber, and moistening the germ-remained rice at a temperature of 20-30° C. and a relative humidity of 88-99% for 1.0-2.0 hours without spraying water, until moisture seeps through the germ-remained rice; and
the germ-remained rice is germ-remained indica rice or germ-remained japonica rice;
the germ-remained indica rice is moistened to a moisture content of not more than 14.5%, and the germ-remained japonica rice is moistened to a moisture content of not more than 15.5%; and
wherein the germ-remained rice moistened is irradiated with an electron beam at a dose of 0.5 to 1.0 kGy and stored at 25° C. from 75-120 days.
2. The method of claim 1, wherein in 1), the germ-remained rice has a germ retention rate of more than or equal to 80%.
3. The method of claim 1, wherein in 1), the germ-remained rice is evenly spread on the sheet tray to a thickness of equal to or less than 2 cm.
4. The method of claim 1, wherein in 2), packing comprises sealing the moistened germ-remained rice in a bag without removing the air; and the germ-remained rice is evenly spread in the bag to a thickness of not more than 1 cm.
5. The method of claim 4, wherein the bag comprises nylon composite.
6. Germ-remained rice treated by the method of claim 1....

Claims

What is claimed is:
1. A few-shot urban remote sensing image information extraction method based on meta learning and attention, the method comprising:
step 1, building a few-shot urban remote sensing information pre-trained model, wherein during a pre-training stage, pre-training network learning is performed for a few-shot set to fully learn feature information of existing samples and obtain initial feature parameters and a deep convolutional network backbone of the few-shot set; the few-shot urban remote sensing information pre-trained model is a network structure comprising a convolutional layer, a pooling layer and a fully-connected layer, and comprises five sections of convolutional network where each section comprises two or three convolutional layers, and an end of each section is connected to one maximum pooling layer to reduce a size of a picture; the number of convolutional kernels inside each section is same, and when closer to the fully-connected layer, the number of convolutional kernels is larger;
step 2, constructing a “time-space-spectrum-angle” attention model to enable the pre-training network to focus on important “time-space-spectrum-angle” information in a training process, suppress noise and redundant information, and improve classification performance of the pre-training model;
step 3, establishing a synergy mechanism of meta learning and attention and realizing few-shot urban remote sensing information extraction, performing parallel association learning for feature parameters obtained by the “time-space-spectrum-angle” attention model and initial feature parameters and introducing a regularizer to minimize cross entropy and structural risk and realize full digging for few-shot information; and
step 4, obtaining remote sensing data through a satellite and fusing a full color image and a multi-spectral image to obtain a multi-spectral image, and using the above three steps to perform urban ground feature information extraction; wherein:
a feature vector of the “time-space-spectrum-angle” is obtained in the following formula:
k
i
′
⇐
k
i
-
η
⁢
∇
k
i
∇
k
i
=
∑
j
=
1
n
⁢
1
[
y
=
i
]
⁢
(
k
i
-
e
j
,
l
)
sum
(
1
[
y
=
i
]
)
v
i
⇐
v
i
-
η
⁢
∇
v
i
∑
j
=
1
C
⁢
(
v
i
,
j
-
η
⁢
∇
v
i
,
j
)
∇
v
i
=
∑
j
=
1
n
⁢
1
[
y
=
i
]
⁢
(
v
i
-
p
j
,
l
)
sum
(
1
[
y
=
i
]
)
wherein ki represents a final category feature center of an i-th category, ki represents an initial category feature center of the i-th category, ∇ represents a gradient, ∇ki represents a gradient-optimized category feature center of the i-th category, j represents a number of unlabeled samples, I represents a number of labeled samples, ej,i represents a feature corresponding to the labeled samples and the unlabeled samples, sum ( ) represents a sum of values in parentheses, vi represents a probability distribution feature center of the i-th category, vi,j represents probability distribution feature centers of the i-th category obtained by updating category probability vectors of j samples of the i-th category, n represents a total number of samples, C represents a number of categories in a dataset, e represents an initial feature vector, p represents a “time-space-spectrum-angle” feature vector, Pj,l represents a prediction probability corresponding to the labeled samples of the l-th category and the unlabeled samples of the j-th category, n represents an update coefficient, and 1(y=i) represents an indicator function.
2. The method of claim 1, wherein the five sections of convolutional network in the few-shot urban remote sensing information pre-trained model is implemented as follows:
a first section of convolutional network comprises two convolutional layers and one maximum pooling layer, with an output channel number being 64 and an output size being 112×112×64;
a second section of convolutional network comprises two convolutional layers and one maximum pooling layer, with an output channel number being 128 and an output size being 56×56×128;
a third section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 256 and an output size being 28×28×256;
a fourth section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 512 and an output size being 14×14×512;
a fifth section of convolutional network comprises three convolutional layers and one maximum pooling layer, with an output channel number being 512 and an output size being 7×7×512;
wherein results output by the five sections of convolutional network are represented as one-dimensional vector in a flattened manner and then input into a Dropout layer corresponding to a first fully-connected layer and then input into a Dropout layer corresponding to a second fully-connected layer and finally input into a third fully-connected layer, wherein an output node of the third fully-connected layer is 1000; and the third fully-connected layer obtains a classification output probability and a classification result by using softmax function at the same time.
3. The method of claim 1, wherein in the “time-space-spectrum-angle” attention model, for a three-dimensional input X, two feature-compressed global feature descriptions are obtained firstly through maximum pooling and average pooling along a channel dimension; then, by a gate mechanism of hard-sigmoid, a weight Xss € (0,1) of a temporal feature, a spatial feature, a spectral feature and an angular feature is obtained; finally, the original input X is multiplied by the weight Xss;
continuous learning is performed by the network in a training process, and a weight corresponding to the important “time-space-spectrum-angle” information approaches 1; and a weight corresponding to non-important or negative noise and redundant information approaches 0.
4. A few-shot urban remote sensing image information extraction system based on meta learning and attention, comprising a processor and a memory, wherein the memory is configured to store program instructions and the processor is configured to invoke the program instructions stored in the memory to perform the few-shot urban remote sensing image information extraction method based on meta learning and attention of claim 1.
5. A few-shot urban remote sensing image information extraction system based on meta learning and attention, comprising a non-transitory computer-readable storage medium, wherein the non-transitory computer-readable storage medium stores computer programs which are executed to perform the few-shot urban remote sensing image information extraction method based on meta learning and attention of claim 1....

Claims

What is claimed is:
1. A method for preparing a carrier for a mercury adsorbent, the method comprising:
1) Mixing hydrated alumina with an organic acid to obtain a mixture A, wherein the organic acid is ethylenediaminetetraacetic acid; and
2) Adding tetraalkylsiloxane to the mixture A, thus obtaining a mixture B; stirring the mixture B in a closed condition; spraying atomized water into the mixture B; and stirring to yield the carrier.
2. The method of claim 1, wherein in 1), hydrated alumina is mixed with the organic acid at −10° C. to 40° C.
3. The method of claim 1, wherein in 1), the organic acid is 1%-10% by mass of the hydrated alumina in the mixture A.
4. The method of claim 3, wherein the organic acid is 6% by mass of the hydrated alumina in the mixture A.
5. The method of claim 1, wherein in 2), the tetraalkylsiloxane is 3%-15% by mass of the hydrated alumina.
6. The method of claim 1, wherein the tetraalkylsiloxane is tetramethylsiloxane or tetraethoxysilane.
7. The method of claim 1, wherein the atomized water is 3-8 times tetraalkylsiloxane by mass.
8. The method of claim 1, wherein in 2), the atomized water is added and stirred for 1-24 h....

Claims

What is claimed is:
1. A method for inhibiting in vivo tumor metastasis within a patient, the method comprising:
A) identifying key heterogeneous molecules driving that drive tumor metastasis by using a prediction system to obtain a sorted list of heterogeneous molecules, the prediction system comprising a non-transitory computer readable storage medium having computer instructions stored in the medium and a processor for executing the computer instructions, identifying the key heterogeneous molecules that drive tumor metastasis by using the prediction system to obtain a sorted list of heterogeneous molecules comprising:
(1) inputting a first quantitative analysis result of proteins and a second quantitative analysis result of proteins to the prediction system; the first quantitative analysis result of proteins is a collection of quantitative analysis results of various protein expression levels in tumor metastases of the patient before drug intervention, and the second quantitative analysis result of proteins is a collection of quantitative analysis results of various protein expression levels in residual tumor metastases of the patient after drug intervention;
(2) comparing, by using the prediction system, the first quantitative analysis result of proteins and the second quantitative analysis result of proteins, and including proteins with expression changes within a predetermined range in a candidate protein set;
(3) constructing, by using the prediction system to employ a protein interaction network analysis tool, experimentally validated protein interaction networks based on the candidate protein set, supplementing the protein interaction networks by utilizing signal pathways of the candidate protein; including most important proteins in each protein interaction network as independent heterogeneous molecules in an independent molecular set; constructing, by using the prediction system to employ a protein interaction network prediction tool and based on the candidate protein set, a protein interaction prediction network according to a protein interaction law; and including proteins in the candidate protein set that do not participate in any protein interaction prediction network as independent heterogeneous molecules in the independent molecular set; and
(4) calculating, by using the prediction system, a hazard ratio (HR) value of each heterogeneous molecule in the independent molecular set, and sorting the heterogeneous molecules based on the HR value, to form the sorted list of heterogeneous molecules; and
B) conducting a sequential intervention on the heterogeneous molecules within the patient by administering to the patient, in sequence, inhibitors or agonists that respectively target the heterogeneous molecules according to an order in the sorted list of heterogeneous molecules, thereby inhibiting in vivo tumor metastasis within the patient.
2. The method of claim 1, wherein the first quantitative analysis result of proteins and the second quantitative analysis result of proteins are acquired through high-throughput protein sequencing; and the high-throughput protein sequencing comprises protein mass spectrometry analysis.
3. The method of claim 1, wherein the proteins with expression changes within the predetermined range are proteins whose expression levels after drug intervention are 0.95-1.05 times higher than those before drug intervention.
4. The method of claim 1, wherein the proteins with expression changes within the predetermined range are first screened and then included in the candidate protein set; the proteins that are screened meet the following conditions: a number of specific peptide segments is ≥2, and is not a predicted protein; a coverage of amino acids of identified peptide segments of a current protein is ≥10%; a quantification frequency of the current protein is ≥2, and a sequencing quality comprehensive score of the current protein is ≥200; evidence in a database shows the current protein is related to tumor progression; the specific peptide segments refer to a specific peptide segment used to identify the current protein; the predicted protein refers to an attribute that defines a reliability of the current protein in Uniport or National Center for Biotechnology Information (NCBI) databases as a predicted protein; the identified peptide segments refer to a specific peptide segment that can be used to indicate the current protein being detected; the quantification frequency of the current protein refers to a number of repetitions of the current protein being quantitatively detected.
5. The method of claim 1, wherein the protein interaction network analysis tool comprises a STRING network tool; the system further comprises a signal pathway database for accessing the signal pathways of the candidate protein, and the signal pathway database comprises Kyoto Encyclopedia of Genes and Genomes (KEGG), Small Molecule Pathway Database (SMPDB), WikiPathways, Cell Signaling Technology, BioCarta Pathway, Pathway Commons, and Pathway Interaction Database (PID); the protein interaction network prediction tool comprises a Gene Multiple Association Network Integration Algorithm (GeneMANIA) network tool, Unified Human Interactome (UniHI) network tool, and Hitpredict network tool.
6. The method of claim 5, wherein the system further comprises a Cytoscape tool for constructing and supplementing the protein interaction networks, and for constructing a protein interaction prediction network.
7. The method of claim 1, wherein the most important proteins in each protein interaction network are identified through characteristic analysis; the characteristic analysis comprises analyzing the importance, degree, and radiancy of each protein in the protein interaction network; and proteins with the highest importance, degree, and radiancy are the most important proteins in the protein interaction network.
8. The method of claim 1, wherein during the calculating and sorting, the HR value of each heterogeneous molecule is calculated as follows: obtaining sequencing data of tumors from a public database, obtaining a standardized counting matrix of genes corresponding to the heterogeneous molecules from the sequencing data, and performing batch single factor Cox regression on the genes to obtain the HR value.
9. The method of claim 8, wherein the public database comprises The Cancer Genome Atlas (TCGA), International Cancer Genome Consortium (ICGC), and Gene Expression Omnibus (GEO).
10. The method of claim 1, wherein during the calculating and sorting, a sorting rule is: the heterogeneous molecules with HR values greater than or equal to 1 are directly sorted in reverse order according to their HR values, and the heterogeneous molecules with HR values less than 1 are sorted in reverse order according to their 1/HR values....

Claims

What is claimed is:
1. A rotor for a disc permanent magnet motor, comprising:
a first rotor core;
a second rotor core; and
a plurality of magnetic tiles;
wherein:
the first rotor core comprises a first annular ring and a plurality of first magnetic blocks protruding at intervals from an outer side of the first annular ring in a circumferential direction, and a first groove is formed between every two adjacent first magnetic blocks;
the second rotor core comprises a second annular ring and a plurality of second magnetic blocks protruding at intervals from an outer side of the second annular ring in a circumferential direction, and a second groove is formed between every two adjacent second magnetic blocks;
the first rotor core and the second rotor core are axially embedded with each other; the first magnetic blocks are embedded in second grooves, and the second magnetic blocks are embedded in first grooves;
each of the plurality of second magnetic blocks comprises two sides, and a first side groove and a second side groove are respectively formed between the two sides and two adjacent first magnetic blocks; an axial thickness H1 of the second magnetic blocks is smaller than an axial thickness H2 of the first magnetic blocks, so that a first top surface of the second magnetic blocks is lower than a second top surface of two adjacent first magnetic blocks, thereby forming a top groove on the second magnetic blocks; and
each of the plurality of magnetic tiles comprises a top tile, a first side tile and a second side tile, and the first side tile and the second side tile are respectively connected to two ends of the top tile; the top tile is embedded in the top groove, and the first side tile and the second side tile are respectively embedded in the first side groove and the second side groove, respectively.
2. The rotor of claim 1, wherein each of the first magnetic blocks is connected to the first annular ring through a first connecting rib; a thickness of the first annular ring is the same as that of the first connecting rib, and the axial thickness of the first magnetic blocks is greater than the thickness of the first annular ring.
3. The rotor of claim 2, wherein each of the second magnetic blocks is connected to the second annular ring through a second connecting rib; a thickness of the second annular ring is the same as that of the second connecting rib, and the axial thickness of the second magnetic blocks is greater than the thickness of the second annular ring.
4. The rotor of claim 3, wherein a cross-sectional shape of the magnetic tile is a “U” shape.
5. The rotor of claim 1, wherein the top tile is a fan-shaped plate.
6. The rotor of claim 5, wherein the first magnetic blocks and the second magnetic blocks are fan-shaped blocks.
7. The rotor of claim 1, wherein the first side tile and the second side tile are flat plates, and are radially aslant embedded into the first side groove and the second side groove, respectively, with an inclination angle α.
8. The rotor of claim 7, wherein the inclination angle α is in the range of 2.5°-7.5°.
9. The rotor of claim 3, wherein the first annular ring is integrated with the first connecting rib and located at a top end of the rotor; the second annular ring is integrated with the second connecting rib and located at a bottom end of the rotor; and the first annular ring is spaced apart from the second annular ring.
10. The rotor of claim 1, wherein the first side tile and the second side tile are perpendicular to the top tile or are inclined relative to the top tile.
11. The rotor of claim 1, wherein two sides of a top surface of each of the first magnetic blocks comprise a first flange, and two first flanges abut against the top tile to limit an axial movement of the magnetic tiles; an inner end and an outer end of each of the second magnetic blocks comprise a second flange, and the top tile is disposed between two second flanges, and thus a radial movement of the magnetic tiles is limited.
12. The rotor of claim 1, wherein magnetization directions of the magnetic tiles are consistent, from inside to outside or from outside to inside.
13. A disc permanent magnet motor comprising a stator assembly and a rotor assembly; wherein the stator assembly is axially magnetically coupled to the rotor assembly, and the rotor assembly comprises the rotor of claim 1....

Claims

What is claimed is:
1. A stator lamination, comprising:
a middle part;
an annular yoke; and
a plurality of stator teeth;
wherein:
the middle part comprises a central hole;
the plurality of stator teeth extend from an inner side of the annular yoke and are evenly distributed on the annular yoke;
a wire slot is formed between every two adjacent stator teeth, whereby a plurality of wire slots are formed on the annular yoke;
each of the plurality of stator teeth comprises a tooth root and a pole shoe disposed at one end of the tooth root;
the stator lamination has an outer diameter D1 ranging from 61.75 mm to 68.25 mm, and the central hole has a diameter D2 ranging from 31.6 mm to 35 mm;
the plurality of wire slots are evenly distributed around an edge of a circle, and a bottom part of each wire slot is tangent to the circle, and the circle has a diameter D3 ranging from 54.72 mm to 60.48 mm;
the tooth root has a tooth width L1 ranging from 4.75 mm to 5.25 mm, and the pole shoe has a thickness H1 ranging from 0.3 L1 to 0.45 L1; and
the stator lamination comprises eight stator teeth and eight wire slots.
2. The stator lamination of claim 1, wherein the tooth width L1 of the tooth root is 5 mm, and the thickness H1 of the pole shoe is in the range of 1.5 mm to 2.25 mm.
3. The stator lamination of claim 2, wherein the annular yoke has a minimum thickness H2 ranging from 3.5 mm to 3.9 mm.
4. The stator lamination of claim 3, wherein the outer diameter D1 of the stator lamination is 65 mm, the central hole has a diameter D2 of 33.3 mm, the diameter D3 of the circle is 57.6 mm, the thickness H1 of the pole shoe is 2.15 mm, and the minimum thickness H2 of the annular yoke is 3.7 mm.
5. The stator lamination of claim 4, wherein each of the plurality of wire slots comprises an arc segment and two straight segments respectively tangent to both ends of the arc segment, and each tooth root comprises a tooth edge perpendicular to the two straight segments.
6. The stator lamination of claim 1, wherein the annular yoke has a minimum thickness H2 ranging from 3.5 mm to 3.9 mm.
7. The stator lamination of claim 6, wherein the outer diameter D1 of the stator lamination is 65 mm, the central hole has a diameter D2 of 33.3 mm, the diameter D3 of the circle is 57.6 mm, the thickness H1 of the pole shoe is 2.15 mm, and the minimum thickness H2 of the annular yoke is 3.7 mm.
8. The stator lamination of claim 7, wherein each of the plurality of wire slots comprises an arc segment and two straight segments respectively tangent to both ends of the arc segment, and each tooth root comprises a tooth edge perpendicular to the two straight segments.
9. An electric motor, comprising:
a rotor assembly;
a stator assembly; and
a casing assembly;
wherein
the stator assembly is disposed inside the casing assembly; the rotor assembly is disposed within the stator assembly;
the stator assembly comprises a stator core, an end insulator, and a plurality of coil windings, and the stator core comprises a plurality of stator laminations stacked together;
the rotor assembly comprises a rotating shaft and a rotor core comprising a plurality of rotor laminations stacked together;
each of the plurality of rotor laminations comprises a shaft hole and a plurality of rotor slots; the rotating shaft is disposed through shaft holes, and the plurality of rotor slots are uniformly distributed around an edge of each of the plurality of rotor laminations; the electric motor further comprises a plurality of conductive elements respectively disposed inside the rotor slots; a rotor tooth is formed between every two adjacent rotor slots; and
each of the plurality of stator laminations comprises eight wire slots; and a ratio of a number of wire slots in each stator lamination to a number of rotor slots in each rotor lamination is in the range of 8:13 to 8:24.
10. The electric motor of claim 9, wherein the ratio of the number of wire slots in each stator lamination to the number of rotor slots in each rotor lamination is 8:15.
11. The electric motor of claim 10, wherein each of the plurality of rotor laminations has a diameter D4 ranging from 31.6 mm to 35 mm; the shaft hole has a diameter D5 ranging from 7.6 mm to 8.4 mm; and the rotor tooth has a width L2 ranging from 2.328 mm to 2.573 mm.
12. The electric motor of claim 11, wherein the diameter D4 of each of the plurality of rotor laminations is 33.3 mm; the diameter D5 of the shaft hole is 8 mm; and the width L2 of the rotor tooth is 2.45 mm....

Claims

What is claimed is:
1. A slew-rate control circuit, comprising:
a proportional calculation circuit, configured to parallelly receive a plurality of first signals within a current preset period, generate a first indicating voltage according to a plurality of adjusted first signals within a previous preset period and the plurality of first signals within the current preset period, and generate a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and a plurality of second signals that are inverted from the plurality of first signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between a number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and a number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
a logic operation circuit, coupled to the proportional calculation circuit, wherein the logic operation circuit is configured to receive the first indicating voltage and the second indicating voltage, and generate an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
an output adjustment circuit, coupled to the logic operation circuit, wherein the output adjustment circuit is configured to receive the operation result, and determine whether to invert the plurality of first signals within the current preset period to correspondingly generate a plurality of adjusted first signals within the current preset period according to the operation result.
2. The slew-rate control circuit of claim 1, wherein the first reference voltage is an upper limit of a preset slew rate range, and the second reference voltage is a lower limit of the preset slew rate range.
3. The slew-rate control circuit of claim 1, wherein the proportional calculation circuit comprises:
a first proportional calculation subcircuit, configured to parallelly receive the plurality of first signals within the current preset period, and generate the first indicating voltage according to the first numerical relationship; and
a second proportional calculation subcircuit, configured to parallelly receive the plurality of first signals within the current preset period, invert the plurality of first signals within the current preset period to obtain the plurality of second signals, and generate the second indicating voltage according to the second numerical relationship.
4. The slew-rate control circuit of claim 3, wherein the first proportional calculation subcircuit comprises a plurality of branches,
wherein the plurality of branches are coupled in parallel, and a voltage value of each first signal within the current preset period is input into a respective one of the plurality of branches,
wherein for each of the plurality of branches, after a transition from a corresponding adjusted first signal of a first level state within the previous preset period to a corresponding first signal of a second level state within the current preset period, this branch conducts when the first level state is different from the second level state, at which time the first indicating voltage is generated at a common end of the plurality of branches.
5. The slew-rate control circuit of claim 4, wherein each branch in the plurality of branches of the first proportional calculation subcircuit comprises a PMOS transistor, an NMOS transistor, and a resistor, wherein the PMOS transistor and the NMOS transistor are coupled in parallel, a first end of the parallel-coupled PMOS transistor and the NMOS transistor receives a voltage value of the corresponding first signal within the current preset period, and a second end of the parallel-coupled PMOS transistor and the NMOS transistor is coupled to the resistor, wherein the NMOS transistor and the PMOS transistor are turned on when the first level state is different from the second level state.
6. The slew-rate control circuit of claim 3, wherein the second proportional calculation subcircuit comprises a plurality of branches,
wherein the plurality of branches are coupled in parallel, and a voltage value of each second signal within the current preset period is input into a respective one of the plurality of branches,
wherein for each of the plurality of branches, after a transition from a corresponding adjusted first signal of a first level state within the previous preset period to a corresponding second signal of a third level state within the current preset period, this branch conducts when the first level state is different from the third level state, at which time the second indicating voltage is generated at a common end of the plurality of branches.
7. The slew-rate control circuit of claim 6, wherein each branch in the plurality of branches of the second proportional calculation subcircuit comprises a PMOS transistor, an NMOS transistor, and a resistor, wherein the PMOS transistor and the NMOS transistor are coupled in parallel, a first end of the parallel-coupled PMOS transistor and the NMOS transistor receives a voltage value of the corresponding second signal within the current preset period, and a second end of the parallel-coupled PMOS transistor and the NMOS transistor is coupled to the resistor, wherein the NMOS transistor and the PMOS transistor are turned on when the first level state is different from the third level state.
8. The slew-rate control circuit of claim 1, wherein the logic operation circuit comprises:
a first operation circuit, coupled to the proportional calculation circuit, configured to generate a first initial operation result according to the numerical relationship between the first indicating voltage, and the first and second reference voltages;
a second operation circuit, coupled to the proportional calculation circuit, configured to generate a second initial operation result according to the numerical relationship between the second indicating voltage, and the first and second reference voltages; and
a third operation circuit, coupled to the first operation circuit and the second operation circuit, configured to receive the first initial operation result and the second initial operation result, perform a logic operation on the first initial operation result and the second initial operation result, and generate the operation result that indicates whether to invert the plurality of first signals within the current preset period.
9. The slew-rate control circuit of claim 8, wherein
when the first indicating voltage is greater than the first reference voltage or less than the second reference voltage, the first initial operation result is in a first logic state; and
when the first indicating voltage is not greater than the first reference voltage and not less than the second reference voltage, the first initial operation result is in a second logic state, wherein the first logic state is different from the second logic state.
10. The slew-rate control circuit of claim 8, wherein
when the second indicating voltage is greater than the first reference voltage or less than the second reference voltage, the second initial operation result is in a third logic state; and
when the second indicating voltage is not greater than the first reference voltage and not less than the second reference voltage, the second initial operation result is in a fourth logic state, wherein the third logic state is different from the fourth logic state.
11. The slew-rate control circuit of claim 8, wherein the first operation circuit comprises:
a first comparator, wherein a non-inverting input end of the first comparator receives the first indicating voltage, an inverting input end of the first comparator receives the first reference voltage, and an output end of the first comparator outputs a first comparison result;
a second comparator, wherein a non-inverting input end of the second comparator receives the second reference voltage, an inverting input end of the second comparator receives the second indicating voltage, and an output end of the second comparator outputs a second comparison result; and
an XOR gate, wherein the XOR gate performs an XOR operation on the first comparison result and the second comparison result, and generates the first initial operation result.
12. The slew-rate control circuit of claim 8, wherein the second operation circuit comprises:
a third comparator, wherein a non-inverting input end of the third comparator receives the first reference voltage, an inverting input end of the third comparator receives the second indicating voltage, and an output end of the third comparator outputs a third comparison result;
a fourth comparator, wherein a non-inverting input end of the fourth comparator receives the second indicating voltage, an inverting input end of the fourth comparator receives the second reference voltage, and an output end of the fourth comparator outputs a fourth comparison result; and
a first AND gate, wherein the first AND gate performs an AND operation on the third comparison result and the fourth comparison result, and generates the second initial operation result.
13. The slew-rate control circuit of claim 8, wherein the third operation circuit comprises:
a second AND gate, coupled to the first operation circuit and the second operation circuit, configured to perform an AND operation on the first initial operation result and the second initial operation result, and generate the operation result.
14. The slew-rate control circuit of claim 8, wherein the operation result in a fifth logic state indicates that that the plurality of first signals within the current preset period are to be inverted; the operation result in a sixth logic state indicates that the plurality of first signals within the current preset period are not to be inverted, wherein the fifth logic state is different from the sixth logic state.
15. The slew-rate control circuit of claim 1, wherein the output adjustment circuit comprises:
a first PMOS transistor and a first NMOS transistor coupled in parallel; and
a second PMOS transistor, a third PMOS transistor, a second NMOS transistor, and a third NMOS transistor coupled in series;
wherein the operation result is input to a control end of the first PMOS transistor and a control end of the third NMOS transistor;
wherein the plurality of first signals are input to a control end of the third PMOS transistor, a control end of the second NMOS transistor, and a common node of the parallel-coupled first PMOS transistor and first NMOS transistor; and
wherein an inverted operation result is input to a control end of the first NMOS transistor and a control end of the second PMOS transistor.
16. A slew-rate control method, comprising:
obtaining, using a proportional calculation circuit, a plurality of first signals within a current preset period, a plurality of adjusted first signals within a previous preset period, and a plurality of second signals that are inverted from the plurality of first signals within the current preset period;
generating, using the proportional calculation circuit, a first indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of first signals within the current preset period, and generating a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of second signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between a number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and a number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
generating, using a logic operation circuit, an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
determining, using an output adjustment circuit, whether to invert the plurality of first signals within the current preset period to correspondingly generate a plurality of adjusted first signals within the current preset period according to the operation result.
17. The slew-rate control method of claim 16, wherein the proportional calculation circuit comprises a first proportional calculation subcircuit and a second proportional calculation subcircuit; wherein the slew-rate control method further comprises:
receiving, using the first proportional calculation subcircuit, the plurality of first signals within the current preset period, and generating the first indicating voltage according to the first numerical relationship; and
receiving, using the second proportional calculation subcircuit, the plurality of first signals within the current preset period, inverting the plurality of first signals within the current preset period to obtain the plurality of second signals, and generating the second indicating voltage according to the second numerical relationship.
18. The slew-rate control method of claim 16, wherein the logic operation circuit comprises a first operation circuit, a second operation circuit, and a third operation circuit, a step of generating the operation result comprises:
generating, using the first operation circuit, a first initial operation result according to the numerical relationship between the first indicating voltage, and the first and second reference voltages;
generating, using the second operation circuit, a second initial operation result according to the numerical relationship between the second indicating voltage, and the first and second reference voltages; and
performing, using the third operation circuit, a logic operation on the first initial operation result and the second initial operation result, and generating the operation result that indicates whether to invert the plurality of first signals within the current preset period.
19. A slew-rate control system, comprising:
a slew-rate control circuit, configured to parallelly receive a plurality of first signals within a current preset period, determine whether to invert the plurality of first signals within the current preset period to generate a plurality of adjusted first signals within the current preset period, according to a level relationship between a level state of each adjusted first signal in a previous preset period and a level state of a corresponding first signal in the current preset period, and a level relationship between a level state of each adjusted first signal in the previous preset period and a level state of a corresponding second signal in the current preset period, wherein a plurality of second signals are obtained by inverting the plurality of first signals within the current preset period; and
a signal output circuit, coupled to the slew-rate control circuit, configured to parallelly output the plurality of adjusted first signals within the current preset period.
20. The slew-rate control system of claim 19, wherein the slew-rate control circuit comprises:
a proportional calculation circuit, configured to parallelly receive the plurality of first signals within the current preset period, generate a first indicating voltage according to a plurality of adjusted first signals within the previous preset period and the plurality of first signals within the current preset period, and generate a second indicating voltage according to the plurality of adjusted first signals within the previous preset period and the plurality of second signals within the current preset period, wherein the first indicating voltage indicates a first numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level first signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level first signals within the current preset period, and the second indicating voltage indicates a second numerical relationship between the number of low-level adjusted first signals within the previous preset period that respectively transition into high-level second signals within the current preset period, and the number of high-level adjusted first signals within the previous preset period that respectively transition into low-level second signals within the current preset period;
a logic operation circuit, coupled to the proportional calculation circuit, configured to generate an operation result according to a numerical relationship between the first indicating voltage, and first and second reference voltages, and a numerical relationship between the second indicating voltage, and the first and second reference voltages, wherein the first reference voltage is greater than the second reference voltage; and
an output adjustment circuit, coupled to the logic operation circuit, configured to receive the operation result, and determine whether to invert the plurality of first signals within the current preset period to correspondingly generate the plurality of adjusted first signals within the current preset period according to the operation result....

Claims

What is claimed is:
1. A method for promoting expression of a foreign gene in a plant, the method comprising: constructing a recombinant vector comprising a soybean gene promoter pEIF1 or an intron-comprising soybean gene promoter pEIF1-I, and introducing the recombinant vector into the plant; the promoter pEIF1 being represented by SEQ ID NO: 5, and the intron-comprising promoter pEIF1-I being represented by SEQ ID NO: 6.
2. The method of claim 1, wherein the foreign gene is beta-glucuronidase (GUS) gene.
3. The method of claim 1, wherein the plant is soybean, and the expression of the foreign gene occurs in cotyledons, radicles, plumules, true leaves, compound leaves, buds, petioles, internodes, roots and root nodules of the soybean.
4. The method of claim 1, wherein the plant is Arabidopsis, and the expression of the foreign gene occurs in whole plant, flower and pod of the Arabidopsis.
5. The method of claim 1, wherein the plant is tobacco, and the expression of the foreign gene occurs in leaves of the tobacco.
6. A method for preparing a recombinant vector comprising a soybean gene promoter, the method comprising inserting a soybean gene promoter pEIF1 or pEIF1-I into a vector pCAMBIA1391Z-BAR, wherein inserting the soybean gene promoter pEIF1 or pEIF1-I into the vector pCAMBIA1391Z-BAR comprises using a PCR amplification fragment of pEIF1 or pEIF1-I as a template, and cloning the PCR amplification fragment into a soybean stable transformation vector pCAMBIA1391Z-BAR by seamless cloning to obtain a soybean stable transformation vector pEIF1-GUS-BAR or pEIF1-I-GUS-BAR;
the vector pCAMBIA1391Z-BAR is obtained by linearizing a vector pCAMBIA1391Z with a restriction enzyme XhoI, and replacing a gene HygR with a gene BAR by seamless cloning;
the recombinant vector pEIF1-GUS-BAR is amplified using the following primers:
pEIF1-GUS-BAR-F:
(SEQ ID NO: 16)
GACCATGATTACGCCAAGCTTGGAGAGAAGTTGAACTCTGAGT
TGTG;
pEIF1-GUS-BAR-R:
(SEQ ID NO: 24)
CCAGTGAATTCCCGGGGATCCCTGATCGTAAATTTAAGGTTTCG;
the recombinant vector pEIF1-I-GUS-BAR is amplified using the following primers:
pEIF1-I-GUS-BAR-F:
(SEQ ID NO: 16)
GACCATGATTACGCCAAGCTTGGAGAGAAGTTGAACTCTGAGT
TGTG;
pEIF1-I-GUS-BAR-R:
(SEQ ID NO: 17)
CCAGTGAATTCCCGGGGATCCAAAACTTGACTCACTAAGACCA
AAGG;
the promoter pEIF1 has a nucleotide sequence of SEQ ID NO: 5, and the promoter pEIF1-I has a nucleotide sequence of SEQ ID NO: 6....

Claims

What is claimed is:
1. A three-axis Hall angle sensor, comprising: four horizontal Hall elements and eight vertical Hall elements disposed on a plane, wherein:
the eight vertical Hall elements are divided into two groups, an X-direction group and a Y-direction group, the X-direction group comprising four vertical Hall elements X1, X2, X3 and X4, and the Y-direction group comprising four vertical Hall elements Y1, Y2, Y3 and Y4; each vertical Hall element comprises four three-contact Hall components, and the four three-contact Hall components are connected end-to-end in series; the four horizontal Hall elements comprising Z1, Z2, Z3 and Z4 are in a 2×2 array arrangement; in the X-direction group, X1 and X2 are located on a left side of the four horizontal Hall elements; X2 is located between X1 and four horizontal Hall elements; X3 and X4 are located on a right side of the four horizontal Hall elements, and X3 is located between X4 and the four horizontal Hall elements;
X1 comprises the four three-contact Hall components, in which middle electrodes are AX1, BX1, CX1 and DX1 in sequence; X2 comprises the four three-contact Hall components, in which middle electrodes are AX2, BX2, CX2, and DX2 in sequence; X3 comprises the four three-contact Hall components, in which middle electrodes are AX3, BX3, CX3 and DX3 in sequence; X4 comprises the four three-contact Hall components, in which middle electrodes are AX4, BX4, CX4 and DX4 in sequence; when measuring an X-direction magnetic field, for a first vertical Hall element X1, applying a current bias between contact electrodes of BX1 and DX1, and measuring a Hall voltage VHallX1 between contact electrodes of AX1 and CX1; for a second vertical Hall element X2, applying a current bias between contact electrodes of BX2 and DX2, and simultaneously measuring a Hall voltage VHallX2 generated between AX2 and CX2; for a third vertical Hall element X3, applying a current bias between contact electrodes of CX3 and AX3, and measuring a Hall voltage VHallX3 between contact electrodes of BX3 and DX3; for a fourth vertical Hall element X4, applying a current bias between the AX4 and CX4 contact electrodes, and measuring a Hall voltage VHallX4 between contact electrodes of DX4 and BX4;
in a Y direction, vertical Hall elements Y1 and Y2 are located on an upper side of the four horizontal Hall elements, and Y2 is located between Y1 and the four horizontal Hall elements; vertical Hall elements Y3 and Y4 are located on a lower side of the four horizontal Hall elements, and Y3 is located between Y4 and the four horizontal Hall elements; Y1 comprises the four three-contact Hall components, in which middle electrodes are AY1, BY1, CY1 and DY1 in sequence; Y2 comprises the four three-contact Hall components, in which intermediate electrodes are AY2, BY2, CY2 and DY2 in sequence; Y3 comprise the four three-contact Hall components, in which intermediate electrodes are AY3, BY3, CY3 and DY3 in sequence; Y4 comprises the four three-contact Hall components, and intermediate electrodes are AY4, BY4, CY4 and DY4 in sequence;
when measuring a magnetic field in the Y direction, the following steps are taken: for a first vertical Hall element Y1, applying a current bias between DY1 and BY1, and measuring a Hall voltage VHallY1 between contact electrodes of AY1 and CY1; for a second vertical Hall element Y2, applying a current bias between BY2 and DY2, and simultaneously measuring a sensing Hall voltage VHallY2 generated between AY2 and CY2; for a third vertical Hall element Y3, applying a current bias between contact electrodes of AY3 and CY3, and measuring a Hall voltage VHallY3 between contact electrodes of DY3 and BY3; for a fourth vertical Hall element Y4, applying a current bias between the BY4 and DY4 contact electrodes, then measuring a Hall voltages VHallY4 between contact electrodes of CY4 and AY4;
each horizontal Hall element comprises four electrodes: A, B, C and D; a first horizontal Hall element Z1 is applied with a bias current between electrodes AZ1 and CZ1, and measuring a Hall voltage VHallZ1 generated between electrodes DZ1 and BZ1; for a second horizontal Hall element Z2, applying a current bias between electrodes BZ2 and DZ2, then measuring a Hall voltage VHallZ2 between electrodes AZ2 and CZ2; for a third horizontal Hall element Z3, applying a current bias between electrodes CZ3 and AZ3, then measuring a Hall voltage VHallZ3 between electrodes BZ3 and DZ3; for a fourth horizontal Hall element Z4, applying a current bias between electrodes DZ4 and BZ4, and measuring a Hall voltage VHallZ4 between electrodes CZ4 and AZ4; and the four identical Hall elements, Z1, Z2, Z3, Z4, are connected together by orthogonal coupling.
2. The three-axis Hall angle sensor of claim 1, wherein a current transmission equation of the three-axis Hall angle sensor Jn is:
J
n
=
J
n
⁢
0
·
M
(
1
)
M
=
1
1
+
a
2
+
b
2
+
c
2
⁢
(
1
+
a
2
ab
-
c
ca
+
b
c
+
ab
1
+
b
2
bc
-
a
ca
-
b
a
+
bc
1
+
c
2
)
(
2
)
a
=
μ
H
·
B
X
(
3
)
b
=
μ
H
·
B
Y
(
4
)
c
=
μ
H
·
B
Z
(
5
)
where Jn0 represents a zero magnetic field electron current density, μH=r·μ and represents a Hall mobility of electrons, r is a Hall coefficient, μ represents an electron mobility, and BX, BY, BZ respectively represent magnetic field components in X, Y and Z directions....

Claims

What is claimed is:
1. A method, comprising:
mixing starch and a first ethanol aqueous solution at a temperature of 90-150° C. to yield a mixture of a V-type granular starch and the first ethanol aqueous solution; and
adding a mixed enzyme comprising alpha-amylase and amyloglucosidase to the mixture of the V-type granular starch and the first ethanol aqueous solution, to enzymatically hydrolyze the V-type granular starch to yield a starch dispersion, wherein an addition amount of the mixed enzyme is 30,000-200,000 U per gram of the V-type granular starch; and vacuum-filtering the starch dispersion, washing for 2 to 3 times with a second ethanol aqueous solution with an ethanol concentration of 95% v/v, drying at 110° C. for 2 h, grinding, and sieving to yield V-type granular porous starch having a specific surface area of 9.99-39.94 m2/g and an average pore size of 26.61-27.61 nm.
2. The method of claim 1, wherein an ethanol concentration of the first ethanol aqueous solution is 50-80% v/v.
3. The method of claim 2, wherein a mass ratio of the starch to the first ethanol aqueous solution is between 1:2 and 1:5.
4. The method of claim 3, wherein the starch is selected from the group consisting of common corn starch, cassava starch, rice starch, barley starch, wheat starch, and potato starch.
5. The method of claim 4, wherein an enzyme activity ratio of the α-amylase to the amyloglucosidase in the mixed enzyme is between 1:2 and 1:5; and the V-type granular starch is enzymatically hydrolyzed at 20-60° C. for 6-12 h.
6. The method of claim 1, further comprising:
(1) adding the starch and the first ethanol aqueous solution to a reactor, to yield the mixture of the V-type granular starch and the first ethanol aqueous solution;
(2) cooling the mixture of the V-type granular starch and the first ethanol aqueous solution in the reactor to a temperature of 25-55° C., and adding the mixed enzyme to the reactor to enzymatically hydrolyze the V-type granular starch to yield the starch dispersion;
(3) carrying out suction filtration on the starch dispersion obtained in (2) by using a vacuum suction filtration device, washing a resulting product by using the second ethanol aqueous solution, drying the product in a first air-drying oven at 110° C. for 2 h, cooling, grinding and screening the product with an 80-mesh screen to obtain the V-type granular porous starch;
(4) dissolving a monoglyceride in het absolute ethanol, to yield a first solution;
(5) adding the V-type granular porous starch prepared in (3) into ethanol, to yield a second solution; and
(6) mixing the first solution and the second solution, carrying out suction filtration on a mixture of the first solution and the second solution, washing a resulting mixture by using the second ethanol aqueous solution, drying the mixture in a second air-drying oven, cooling, and grinding the mixture.
7. The method of claim 6, wherein in (1), the reactor operates at a rotating speed of 500 r/min for 0.5 hour; an ethanol concentration of the first ethanol aqueous solution is 50-90% v/v; a concentration of the starch is 10-40% v/v; and when a temperature in the reactor decreases to 60° C., a reaction between the starch and the first ethanol aqueous solution stops.
8. The method of claim 6, wherein in (2), the mixed enzyme is 4 mL of a mixed solution of α-amylase and amyloglucosidase with a ratio thereof 1:4; an enzymolysis time is 4-12 h; an enzymolysis temperature is 25-55° C.; and a rotating speed of a stirring blade in the reactor is 100-900 r/min.
9. The method of claim 6, wherein in (6), the first solution and the second solution are mixed at 25° C. for 2 hours at a rotating speed of 500 r/min; the resulting mixture is washed by the second ethanol aqueous solution having a concentration of 95% v/v for 2 to 3 times, dried at 50° C. for 12 h, ground and screened with an 80-mesh screen.
10. A V-type granular porous starch, prepared by the method of claim 1, having an oil adsorption rate of 276.33-528.58% by weight, and a water adsorption rate of 410.24-847.80% by weight....

Claims

What is claimed is:
1. A cutting tool for machining titanium alloy or superalloy, comprising a Me-B-N coating, wherein Me is one or more elements selected from the transition metals V, Nb, Ta, and Mo; the atomic percentages of each element are as follows: Me: 8-40% B: 15-60%, and N: 10-65%; and the Me—B—N coating comprises a MeNx phase and a BN phase.
2. The cutting tool of claim 1 wherein the Me-B-N coating has a thickness of 0.3-5 μm....

Claims

What is claimed is:
1. A method for predicting multi-type electrocardiogram (ECG) heart rhythms, the method comprising:
(1) acquiring 12-lead ECG signals from a body surface of a patient, and resampling an ECG signal of each lead to a same signal length;
(2) constructing a node mutual information pooling U-shaped graph convolution network, and extracting deep features of the ECG signals by using a feature extraction module in the graph convolution network;
(3) performing one-layer one-dimensional convolution on the deep features to obtain a graph feature matrix to be constructed, where rows of the graph feature matrix correspond to various types of arrhythmias to be predicted, and columns of the graph feature matrix correspond to feature vectors corresponding to the various types of arrhythmias; and, converting the graph feature matrix into an undirected graph G(V, A, E, W, X), where V is a point set of the undirected graph, and each node in the point set corresponds to each type of arrhythmias; E is an edge set of the undirected graph, which records a similarity between nodes; W is a weight matrix, which gives different weights to different edges; X is a node feature matrix; and, A is a node adjacency matrix;
(4) inputting the obtained undirected graph into a graph encoding module in the graph convolution network, quantitatively calculating node mutual information of the undirected graph by using the graph encoding module, and selecting a node subset with maximum mutual information to decrease a number of nodes in the undirected graph for down-sampling;
(5) inputting the undirected graph with decreased number of nodes into a graph decoding module in the graph convolution network, up-sampling, by using the graph decoding module, the undirected graph according to existing node indexes to restore an original number of nodes so as to generate a new graph feature matrix, and adding the new graph feature matrix with the graph feature matrix before down-sampling and outputting an aggregate graph feature matrix;
(6) performing summation, maximization, minimization and averaging on the aggregate graph feature matrix, splicing a result obtained after four operations into a feature vector and inputting the feature vector into a fully-connected layer, and finally mapping to obtain a probability value of each type of arrhythmias; and
(7) training the graph convolution network through a cross entropy loss function by using a large amount of ECG data and labels of various arrhythmias to predict multi-type ECG heart rhythms.
2. The method of claim 1, wherein the feature extraction module comprises a one-dimensional convolution layer, a residual network ResNet34, and an average pooling layer which are successively connected to one another, and all convolution layers in the residual network ResNet34 are replaced by one-dimensional convolution.
3. The method of claim 1, wherein the graph encoding module selects the node subset with the maximum mutual information by using the following formula:
max
Ω
⊂
V
C
⁡
(
Ω
)
;
C
⁡
(
Ω
)
=
1
K
⁢
∑
v
∈
Ω
log
⁢
σ
⁡
(
T
w
(
x
v
,
y
𝒩
v
)
)
+
1
K
2
⁢
∑
v
,
u
∈
Ω
log
⁡
(
1
-
σ
⁡
(
T
w
(
x
v
,
y
𝒩
u
)
)
)
;
T
w
(
x
v
,
y
𝒩
v
)
=
𝒮
w
(
ℰ
w
(
x
v
)
,
𝒫
w
(
y
𝒩
v
)
)
;
T
w
(
x
v
,
y
𝒩
u
)
=
𝒮
w
(
ℰ
w
(
x
v
)
,
𝒫
w
(
y
𝒩
u
)
)
;
where Ω denotes the node subset; K is the number of nodes in the node subset Ω; V is the point set of the undirected graph; C(Ω) is a mutual information quantization function between neighboring nodes in the node subset Ω; v is any node in the node subset Ω; xv denotes the feature vector of the node v; σ( ) is a sigmoid activation function; v denotes all neighboring nodes of the node v; yNv is a feature matrix comprising the feature vectors of all neighboring nodes of the node v; w( ) is a vertex embedding function; w( ) is a neighborhood embedding function; Sw( ) is a vertex-neighborhood affinity function, which has the same function as w( ) and aggregates the result of w(xv); w( ) and w( ) are implemented by a multi-layer perceptron; and, w( ) is implemented by R-hop graph convolution.
4. The method of claim 1, wherein after up-sampling or down-sampling the undirected graph, the corresponding graph feature matrix is subjected to one-layer graph convolution to update features of all nodes in the undirected graph.
5. The method of claim 1, wherein in the process of training the graph convolution network in (7), parameters in the network are iteratively updated by an Adam algorithm until the cross entropy loss function is converged.
6. The method of claim 1, wherein the cross entropy loss function is expressed as follows:
L
=
{
l
1
,
…
,
l
N
}
⊤
;
l
n
=
-
w
n
[
y
n
·
log
⁢
x
n
+
(
1
-
y
n
)
·
log
⁡
(
1
-
x
n
)
]
;
w
n
=
1
log
⁡
(
Sum
(
lable
n
)
)
;
where L is the cross entropy loss function; ln is a loss function value of a nth type of arrhythmias; N is a number of arrhythmia disease types, n is a natural number and 1≤n≤N; wn is correspondingly a weight value of the nth type of arrhythmias; xn is a predicted probability value of the nth type of arrhythmias correspondingly output by inputting the current ECG signal into the graph convolution network; yn is a label value of the nth type of arrhythmias corresponding to the current ECG signal; and, Sum(lablen) is a number of training data labels about the nth type of arrhythmias.
7. The method of claim 1, wherein in (4), node mutual information pooling is a core of the graph encoding module; a graph pooling part is associated with node selection and new graph structure generation; a mutual information score between a node and a neighboring node is calculated in the graph pooling part, and top K node indexes with the highest score are returned.
8. The method of claim 1, wherein in (5), previously recorded node indexes are required during up-sampling, and a new graph feature matrix X′=O∈{0}N×d is generated; N is a number of arrhythmia disease types, and d is a dimension of feature; the graph feature matrix to be up-sampled is added with a down-sampled graph feature matrix in the same layer to obtain an up-sampled graph feature matrix....

Claims

CLAIM
1. The ornamental design for a brush head for an electric toothbrush as shown and described....

Claims

What is claimed is:
1. A device, comprising:
a power unit; and
a plurality of adjustment units;
wherein:
the plurality of adjustment units is disposed around a suspension cable to be replaced; the power unit is configured to power the plurality of adjustment units;
each of the plurality of adjustment units comprises a support frame, a connector, and a steel strand;
the power unit comprises two jacks, each jack comprising a main body;
the support frame is door-shaped and comprises two support columns, a top part, and a bottom part; the top part comprises a first through hole, and a nut fixed on an anchor is disposed in the first through hole; a hanger rod is disposed through the anchor and the nut, and fixed in the nut;
the bottom part comprises a second through hole, and the steel strand is disposed through the second through hole;
the connector is disposed in a central cavity of the support frame; one end of the connector is screwed to a first end of the hanger rod, and a second end of the connector is fixedly connected to one end of the steel strand; another end of the steel strand is fixedly connected to the main body of each jack; and
the bottom part of the support frame abuts against a top surface of each jack; and the top part of the support frame abuts against a bottom surface of the anchor.
2. The device of claim 1, wherein each of the two jacks is a hydraulic jack; the power unit further comprises a hydraulic hose and a post-tension stressed oil pump; each hydraulic jack comprises an oil inlet and the post-tension stressed oil pump comprises an oil outlet; and the oil outlet is connected to the oil inlet through the hydraulic hose.
3. The device of claim 2, wherein the power unit further comprises a three-way hydraulic connector disposed between the post-tension stressed oil pump and the two hydraulic jacks.
4. The device of claim 1, wherein the device comprises two adjustment units disposed symmetrically about the suspension cable.
5. The device of claim 4, wherein the connector is an anchorage connector.
6. The device of claim 5, wherein each of the two jacks is a core-through hydraulic jack; and the steel strand passes through each core-through hydraulic jack.
7. The device of claim 6, wherein the second through hole is disposed in a center of the bottom part of the support frame and is aligned with the core-through hydraulic jack....

Claims

What is claimed is:
1. An auxiliary support device for a rolling-cut shear, comprising:
a lower cutting table;
a plurality of first hydraulic support cylinders;
a plurality of support plates;
a plurality of second hydraulic support cylinders shorter than the plurality of first hydraulic support cylinders;
a slide plate; and
a plurality of horizontal hydraulic cylinders;
wherein
the lower cutting table comprises a first front end comprising a first mounting groove for receiving a lower shear blade of the rolling-cut shear, a second mounting groove, and an inner plate;
a bottom wall of the second mounting groove comprises a plurality of first bolt holes and a plurality of first recesses;
the inner plate is embedded in the second mounting groove through a plurality of bolts passing through the plurality of first bolt holes;
the inner plate comprises a plurality of second bolt holes and a plurality of second recesses; and the plurality of support plates lean against the inner plate;
the plurality of first hydraulic support cylinders and the plurality of horizontal hydraulic cylinders are disposed in the plurality of first recesses; each of the plurality of first hydraulic support cylinders comprises a first support rod; the slide plate comprises a first transverse plate, a second transverse plate, a third transverse plate, and a fourth transverse plate; a top end of the first support rod abuts against a bottom end of the fourth transverse plate; a second front end of each of the plurality of first hydraulic support cylinders is connected to a first rear end of each of the plurality of second hydraulic support cylinders through a connection rod; each of the plurality of second hydraulic support cylinders comprises a second support rod; and bottom ends of the first transverse plate, the second transverse plate, and the third transverse plate abut against top ends of second support rods, respectively; and
each of the plurality of horizontal hydraulic cylinders comprises a third support rod, and a second rear end of each of the plurality of first hydraulic support cylinders is connected to a third front end of the third support rod.
2. The device of claim 1, wherein the plurality of first hydraulic support cylinders synchronously control corresponding first support rods to extend and retract; the plurality of second hydraulic support cylinders synchronously control corresponding second support rods to extend and retract; the first support rods and the second support rods synchronously extend and retract with a speed; the plurality of horizontal hydraulic cylinders synchronously control corresponding third support rods to extend and retract; all hydraulic support cylinders are a hydraulic servosystem, and each of the hydraulic support cylinders is equipped with a built-in magnetostrictive displacement sensor to provide real-time feedback on a position of a corresponding support rod.
3. The device of claim 2, wherein a first bottom surface of each of the plurality of first hydraulic support cylinders and each of the plurality of second hydraulic support cylinders comprises a sliding groove configured to fit with a slide rail fixed on ground of a workshop; a top surface of the slide rail is flush with a second bottom surface of the lower cutting table; and a leading end of the slide rail is oriented to the same direction as a leading end of the lower cutting table.
4. The device of claim 3, wherein second rear ends of the plurality of first hydraulic support cylinders are embedded in the plurality of second recesses and the plurality of first recesses; the plurality of second recesses and the plurality of first recesses are in line with slide rails; two sides of the plurality of horizontal hydraulic cylinders are disposed in the plurality of first recesses; a third bottom surface of each of the plurality of horizontal hydraulic cylinders is flush with second bottom surface of the lower cutting table; and a third rear end of each of the plurality of horizontal hydraulic cylinders is disposed in the plurality of first recesses.
5. The device of claim 1, wherein the inner plate is attached to the bottom wall of the second mounting groove, and a longitudinal width of the inner plate is less than a longitudinal width of the second mounting groove; a width difference between the inner plate and the second mounting groove is equal to a thickness of the fourth transverse plate plus a mounting margin; the fourth transverse plate is parallel to the lower cutting table and is disposed in a gap between the inner plate and the second mounting groove; and a depth of the second mounting groove is equal to a width of the fourth transverse plate.
6. The device of claim 1, wherein bottom ends of the plurality of support plates are flush with a bottom end of the inner plate, and each of the bottom ends of the plurality of support plates comprises a right-angle groove for fitting and approaching the plurality of support plates to the second mounting groove of the lower cutting table; top ends of the plurality of support plates are flush with a top end of the inner plate, and the plurality of support plates abut at intervals against an outer wall of the inner plate....

Claims

What is claimed is:
1. An outer rotor of a motor, the outer rotor comprising: an annular rotor core and a plurality of permanent magnets; wherein the annular rotor core comprises a central hole; the annular rotor core further comprises a plurality of slots, and the plurality of permanent magnets are disposed in the plurality of slots and form a plurality of magnetic poles along a circumferential direction of the rotor core;
each magnetic pole comprises three shapes of permanent magnet: a first arc-shaped permanent magnet concentric with the rotor core and having a uniform thickness, a second arc-shaped permanent magnet not concentric with the rotor core, and a rectangular permanent magnet;
in each magnetic pole, the three shapes of permanent magnet are symmetrically arranged along a center line L of the magnetic pole, and the first arc-shaped permanent magnet, the second arc-shaped permanent magnet and the rectangular permanent magnet are sequentially spaced radially from inside to outside;
an inner arc-shaped surface of the first arc-shaped permanent magnet and an inner circular sidewall of the rotor core are of equal radius and form a flush structure;
one magnetic pole comprises at least three first arc-shaped permanent magnets, one second arc-shaped permanent magnet, and two rectangular permanent magnets; the at least three first arc-shaped permanent magnets are arranged at intervals along the circumferential direction of the rotor core, and a magnetic channel is formed between every two adjacent first arc-shaped permanent magnets;
the second arc-shaped permanent magnet is located between the at least three first arc-shaped permanent magnets and the rectangular permanent magnet, and the second arc-shaped permanent magnet is not in contact with the inner circular sidewall and outer circular sidewall of the rotor core; and an inner arc surface of the second arc-shaped permanent magnet covers at least one first arc-shaped permanent magnet and at least two magnetic channels.
2. The outer rotor of claim 1, wherein each magnetic pole has a central angle α3, α3=360°/2P, where P is a number of pairs of the magnetic poles on the rotor core; 1.5*α3>α1>0.5*α3, and 1.5*α3<α2<3*α3, where α1 is an included angle between the center line L of the magnetic pole and the rectangular permanent magnet, and α2 is a central angle of the second arc-shaped permanent magnet.
3. The outer rotor of claim 2, wherein the included angle α1 between the center line L of the magnetic pole and the rectangular permanent magnet is less than 90°, and the central angle α2 of the second arc-shaped permanent magnet is 45°<α2<180°.
4. The outer rotor of claim 3, wherein the first arc-shaped permanent magnets are three or four in number.
5. The outer rotor of claim 4, wherein the first arc-shaped permanent magnets have a thickness d, and the rotor core has a thickness D, where 0.16*D6. The outer rotor of claim 5, wherein a minimum distance between the second arc-shaped permanent magnet and the outer circular sidewall of the rotor core is L2, and 0.15*D7. The outer rotor of claim 6, wherein a minimum distance between the rectangular permanent magnet and the second arc-shaped permanent magnet is L3, and 0.15*D8. The outer rotor of claim 7, wherein the rotor core further comprises first auxiliary slots on both ends of the rectangular permanent magnet; a first narrow magnetic bridge is formed between one first auxiliary slot and the outer circular sidewall to reduce magnetic leakage; the rotor core further comprises second auxiliary slots on both ends of the second arc-shaped permanent magnet; a second narrow magnetic bridge is formed between one second auxiliary slot and an outer arc surface of the first arc-shaped permanent magnets to reduce magnetic leakage; and both the first auxiliary slots and the second auxiliary slots are filled with non-magnetic permeable materials.
9. The outer rotor of claim 8, wherein the second arc-shaped permanent magnet has a uniform thickness or is thick in the middle and thin at both ends.
10. The outer rotor of claim 8, wherein the first arc-shaped permanent magnet, the second arc-shaped permanent magnet, and the rectangular permanent magnet all comprise ferrite material; or, the first arc-shaped permanent magnet comprises neodymium iron boron material, and the second arc-shaped permanent magnet and the rectangular permanent magnet both comprise ferrite material.
11. A permanent magnet synchronous motor, comprising a stator assembly and the outer rotor of claim 1....

Claims

What is claimed is:
1. A method, comprising:
(1) collecting a plurality of activated sludge samples, acquiring raw data of images of the plurality of activated sludge samples, cleaning the raw data of the images, and standardizing data sizes of the images;
(2) calculating a sludge volume index (SVI) for each of the plurality of activated sludge samples;
(3) establishing, by using a ResNet50 deep neural network, a model for predicting the settleability of activated sludge; and
(4) predicting the settleability of a target activated sludge using the model established in (3);
wherein, (3) is implemented as follows:
(301) separating, by using the sludge volume index for each of the plurality of activated sludge samples obtained in (2), the plurality of activated sludge samples into a bulking sample set and a non-bulking sample set;
(302) augmenting the bulking sample set or the non-bulking sample set, to equalize the sample sizes between the bulking sample set and the non-bulking sample set;
(303) dividing a dataset for establishing the model into a training set, a validation set, and a testing set, and optimizing hyperparameters of the model;
(304) selecting optimal hyperparameters of the model, training the model to predict the settleability of activated sludge, and assessing a classification performance of the model using the testing set.
2. The method of claim 1, wherein in (1), the raw data of the images of the plurality of activated sludge samples are acquired using a high-throughput image acquisition system, and the raw data of the images is cleaned by removing blurry images and erroneous samples.
3. The method of claim 1, wherein in (2), for each of the plurality of activated sludge samples, the sludge volume index (SVI) is calculated using experimentally determined settled sludge volume (SV) and mixed liquor suspended solids (MILSS) concentration, following a calculation formula:
SVI
⁡
(
mL
·
g
-
1
)
=
S
⁢
V
⁡
(
mL
·
L
-
1
)
MLSS
⁡
(
g
·
L
-
1
)
.
4. The method of claim 1, wherein in (301), a threshold for SVI is defined; when the SVI of the activated sludge falls below the SVI threshold, the activated sludge sample is classified as bulking; otherwise, the activated sludge sample is classified as non-bulking; and the SVI threshold is set within the range of 150 to 190 mL·g−1.
5. The method of claim 1, wherein in (302), the augmenting comprises separately rotating the images by 90°, 180°, and 270° for the bulking sample set or the non-bulking sample set.
6. The method of claim 1, wherein in (303), the dataset is split into the training set and the testing set in proportion; during model training process, the training set is further automatically split into an operational training set and a validation set.
7. The method of claim 1, wherein in (303), the hyperparameters of the model are optimized; the hyperparameters comprise an optimizer and a learning rate; the optimizer is stochastic gradient descent; and the learning rate is optimized using a ReduceLROnPlateau callback function, thereby improving a speed of network convergence during training.
8. The method of claim 1, wherein in (304), while training the model to predict the settleability of activated sludge, a loss is calculated using a cross-entropy loss function.
9. The method of claim 1, wherein in (304), when assessing the classification performance of the model using the testing set, four metrics—Accuracy, Precision, Recall, and F1 score are used to measure and analyze classification capabilities of the model; the formula for calculating Accuracy is as follows:
Accuracy
⁢
=
T
⁢
P
+
T
⁢
N
T
⁢
P
+
F
⁢
P
+
T
⁢
N
+
F
⁢
N
;
the formula for calculating Precision is as follows:
Precision
⁢
=
T
⁢
P
T
⁢
P
+
F
⁢
P
the formula for calculating Recall is as follows:
Recall
=
T
⁢
P
T
⁢
P
+
F
⁢
N
the formula for calculating F1 score is as follows:
F
⁢
1
⁢
Score
=
2
×
precision
×
recall
precision
+
recall
;
where TP represents true positives, indicating instances where actual positive samples are correctly predicted as positive; TN represents true negatives, indicating instances where actual negative samples are correctly predicted as negative; FP represents false positives, indicating instances where actual negative samples are incorrectly predicted as positive; FN represents false negatives, indicating instances where actual positive samples are incorrectly predicted as negative.
10. The method of claim 1, wherein (4) is implemented as follows:
(401) collecting a plurality of activated sludge samples to be tested; and acquiring, by using a high-throughput image acquisition system, image data of the plurality of activated sludge sample to be tested;
(402) automatically standardizing the data sizes of the images for the plurality of activated sludge sample to be tested; and
(403) inputting standardized image data of the plurality of activated sludge samples to be tested into the model, generating operational output results, and thereby determining whether the tested activated sludge samples have undergone bulking....

Claims

What is claimed is:
1. A crystalline form B of a 2-(2,4,5-substituted phenylamino) pyrimidine derivative of formula I:
wherein a CuKα-X-ray powder diffraction (XRPD) spectrum of the crystalline form B comprises diffraction peaks at diffraction angle 2θ positions of 8.55°±0.2°, 9.47°±0.2°, 10.31°±0.2°, 12.65°±0.2°, 14.47°±0.2°, 15.17°±0.2°, 15.61°±0.2°, 16.29°±0.2°, 17.07°±0.2°, 17.31°±0.2°, 17.73°±0.2°, 18.22°±0.2°, 18.74°±0.2°, 19.47°±0.2°, 19.70°±0.2°, 20.24°±0.2°, 20.72°±0.2°, 21.68°±0.2°, 22.08°±0.2°, 22.80°±0.2°, 23.50°±0.2°, 23.99°±0.2°, 24.20°±0.2°, 24.83±0.2°, 25.65°±0.2°, 26.15±0.2°, 26.99°±0.2°, 27.69°±0.2°, 28.30°±0.2°, 29.57°±0.2°, 30.74°±0.2°, and 32.58°±0.2°.
2. A method of treatment of non-small cell lung cancer, the method comprising administering to a patient in need thereof an effective amount of the crystalline form B of the 2-(2,4,5-substituted phenylamino) pyrimidine derivative of claim 1.
3. The method of claim 2, wherein the method further comprises administering to the patient another lung cancer therapeutic drug....

Claims

What is claimed is:
1. A device, comprising:
a housing;
a plurality of supporting rods;
a roof plate;
a mixing room;
a lifting mechanism;
a stirring mechanism;
a control mechanism comprising a first conductive block and a second conductive block;
a driving mechanism; and
a cleaning mechanism;
wherein:
the housing comprises a top end and one end of each of the plurality of supporting rods is disposed on the top end, and the roof plate is disposed on the other end of each of the plurality of supporting rods;
the stirring mechanism is fixed on the roof plate;
the mixing room comprises a bottom wall and the housing comprises an inner bottom surface; the mixing room comprises a discharge port disposed on the bottom wall, and a seal plug disposed in the discharge port;
the lifting mechanism is disposed between the bottom wall and the inner bottom surface and an outer sidewall of the mixing room abuts against an inner sidewall of the housing;
the cleaning mechanism is disposed over the stirring mechanism;
the stirring mechanism comprises a stirring part and a rotating rod; the stirring part extends into the mixing room and the rotating rod is configured to move the first conductive block to abut against the second conductive block; and
the control mechanism is electrically connected to the stirring mechanism and the driving mechanism.
2. The device of claim 1, wherein the stirring mechanism comprises a rotating shaft, a plurality of stirring rods, and a driving member; the rotating shaft is flexibly connected through a first bearing to the roof plate; the rotating shaft is connected to the driving member via a transmission; and the plurality of stirring rods is disposed on two sides of the rotating shaft.
3. The device of claim 2, wherein the driving member comprises a motor, a driving wheel, and a driven wheel; the motor is fixed on the roof plate; an output terminal of the motor is connected to the driving wheel; the driven wheel is connected to the rotating shaft; and the driving wheel is engaged with the driven wheel.
4. The device of claim 2, wherein the cleaning mechanism comprises a U-shaped rod, four cleaning members, and a plurality of fixing rods; the driving mechanism comprises a movable end and the U-shaped rod is fixedly connected to the movable end; the U-shaped rod comprises a bottom end and the plurality of fixing rods are fixedly connected to the bottom end; and the four cleaning members are fixedly connected to the plurality of fixing rods and are divided into two groups opposite to each other to clean the plurality of stirring rods on two sides of the rotating shaft, respectively.
5. The device of claim 4, wherein the driving mechanism comprises a frame, a drive motor, a leadscrew, and a threaded sleeve; the frame comprises a lower portion and the drive motor is disposed on the lower portion; an output of the drive motor is connected to the leadscrew; the leadscrew comprises a distal end away from the drive motor and the distal end is connected through a second bearing to an upper portion of the frame; and the threaded sleeve is disposed around the leadscrew and is connected to the U-shaped rod via a connection rod.
6. The device of claim 1, wherein the lifting mechanism comprises a first controller and a telescopic cylinder; the first controller comprises a switch button and is electrically connected to the telescopic cylinder; and an output end of the telescopic cylinder is fixedly connected to the bottom wall of the mixing room.
7. The device of claim 1, wherein the control mechanism further comprises a controller and a power supply; the first conductive block is movable and is connected to the rotating rod; the second conductive block is immovable and abuts adapted to be abut against the first conductive block; the first conductive block and the power supply are electrically connected to the controller; and the second conductive block is electrically connected to the power supply.
8. The device of claim 7, wherein when the first conductive block abuts against the second conductive block, the controller is powered on by the power supply....

Claims

The invention claimed is:
1. A punching bag, comprising:
a main body module; and
a plurality of digital display modules;
wherein:
the main body module is a modularized body for boxing training, and comprises a cylinder body, a pillar, and a flange;
the cylinder body comprises a first member and a second member;
the first member comprises an upper part and a lower part integrated with the upper part; the upper part is cylindrical and the lower part is semicylindrical; the upper part comprises a central axial hole; the lower part comprises a first rectangular surface and a first axial semicircular groove disposed in a middle of the first rectangular surface; the first axial semicircular groove extends to communicate with the central axial hole of the upper part; diameters of the first axial semicircular groove and the central axial hole correspond to a diameter of the pillar;
the second member is semicylindrical, and comprises a second rectangular surface and a second axial semicircular groove disposed in a middle of the second rectangular surface; a diameter of the second axial semicircular groove corresponds to the diameter of the pillar;
the first member is in embedded connection to the second member to form the cylinder body; the first axial semicircular groove cooperates with the second axial semicircular groove to form an axial hole to receive the pillar;
the cylinder body is supported by the flange and locked by the pillar;
the main body module further comprises a buffer layer and an outer layer; the buffer layer is disposed between the cylinder body and the outer layer; a counterweight base is fixed on one end of the pillar; the buffer layer comprises a plurality of grooves, and the plurality of digital display modules are embedded in the plurality of grooves, respectively; and
each of the plurality of digital display modules comprise a touchscreen cover, a chip, a base plate, a light-emitting diode, and a pressure sensor; the chip comprises a front side and a back side, and the light-emitting diode is disposed on the front side and the pressure sensor is disposed on the back side; the touchscreen cover comprises a curved outer surface and translucent resilience material; the touchscreen cover further comprises a thickened center part comprising a plurality of dents; the touchscreen cover is attached to the base plate through an adhesive; the chip is connected to the digital control panel through a lead wire; an adapter sleeve is disposed on a back side of the digital control panel and sleeves the pillar.
2. The punching bag of claim 1, wherein the pressure sensor is a three-contact structure; a joint of the chip and the touchscreen cover and four contact corners of the chip and the base plate are provided with locating holes and locating pins; and a reinforcing rib is disposed on a back side of the base plate.
3. The punching bag of claim 1, wherein the cylinder body is a molded resilient structure or a container structure comprising a filler; the container structure is blow molded; the first member comprises a first top end comprising a first filling opening; and the second member comprises a second top end comprising a second filling opening.
4. The punching bag of claim 1, wherein an embedded part is disposed on an outer surface of a joint of the first member and the second member; the embedded part is a concave platform comprising connecting holes; and screws pass through the connecting holes to fixedly connect the first member and the second member.
5. The punching bag of claim 3, wherein a recess is disposed on a bottom of the upper part of the first member, and the second filling opening of the second member is located in the recess; and a vertical height ratio of the first member to the second member is 2:1.
6. The punching bag of claim 1, wherein a fixed bar and a non-skid tape are disposed on the pillar; the fixed bar is disposed at a lower part of a top end of the pillar, and the top end of the pillar is embedded in the central axial hole; and two ends of the fixed bar are disposed on a top side of the first rectangular surface of the first member....

Claims

What is claimed is:
1. An aryl sulfide of formula I, or an agriculturally acceptable salt thereof,
wherein:
n is 0 or 1;
X is fluorine, chlorine, or methyl;
Y is chlorine or methyl;
R1 is hydrogen, fluorine, chlorine, bromine, hydroxyl, nitro, hydroxymethyl, a cyano group, trifluoromethyl, C1-3 alkyl, C1-4 alkoxycarbonyl, acetyl, propionyl, C1-3 alkoxy, ethylthio, 2-fluoroethanothioxy, 2-chloroethanothioxy, 2,2-difluoroethylthio, 2,2,2-trifluoroethylthio, propylthio, 2,2,2-trifluoroethylsulfinyl, vinyloxycarbonyl, 2,2,2-trifluoroethoxycarbonyl, or n-methylcarbonyl;
R2 is hydrogen, fluorine, or chlorine;
R3 is hydrogen, fluorine, chlorine, bromine, or a cyano group;
R4 and R5 at each occurrence represent hydrogen; and
R6 is n-propyl or 2,2,2-trifluoroethyl.
2. The aryl sulfide of claim 1, wherein
n is 0 or 1;
X is fluorine;
Y is chlorine or methyl;
R1 is methoxycarbonyl, ethoxycarbonyl, ethylthio, or 2,2,2-trifluoroethylthio;
R2, R4, and R5 at each occurrence represent hydrogen;
R3 is hydrogen, fluorine, chlorine, or a cyano group; and
R6 is 2,2,2-trifluoroethyl.
3. The aryl sulfide of claim 1, wherein the aryl sulfide is:...

Claims

What is claimed is:
1. A rolling mechanism for grain refinement of a metal rod, comprising two main rolls and two auxiliary rolls; wherein:
the two main rolls are opposite to each other and the two auxiliary rolls are opposite to each other, and the two main rolls and the two auxiliary rolls are disposed around a rolling line to form a nip zone where a billet is rolled into the metal rod;
in any cross section of the nip zone with the rolling line as a normal line, a first line connecting central axes of the two main rolls is perpendicular to a second line connecting central axes of the two auxiliary rolls;
each main roll comprises a first protrusion portion, a first end portion and a second end portion; the first end portion and the second end portion are disposed opposite each other along a corresponding roll axis; the first end portion has a smaller diameter than the second end portion; the first protrusion portion is disposed between the first end portion and the second end portion;
each auxiliary roll comprises a second protrusion portion, a third end portion and a fourth end portion; the third end portion and the fourth end portion are disposed opposite each other along a corresponding roll axis; the third end portion has a smaller diameter than the fourth end portion; the second protrusion portion is disposed between the third end portion and the fourth end portion; and
the first protrusion portion has a greater diameter than the second protrusion portion; a narrow space of the nip zone is surrounded by the two first protrusion portions of the two main rolls and the two second protrusion portions of the two auxiliary rolls; the first end portion is disposed adjacent to the fourth end portion; and the second end portion is disposed adjacent to the third end portion.
2. The rolling mechanism of claim 1, wherein
a ratio of a length of the first line to a length of the second line is a constant ranging from 1-1.1; and/or
the two main rolls and the two auxiliary rolls have the same length; the first protrusion portion is disposed on a midpoint of a first axis from the first end portion to the second end portion; and the second protrusion portion is disposed on a midpoint of a second axis from the third end portion to the fourth end portion.
3. The rolling mechanism of claim 1, wherein:
the two main rolls and the two auxiliary rolls separately comprise at least three truncated cones arranged along a corresponding roll axis; each truncated cone comprises a top surface and a base surface; every two adjacent truncated cones are connected by attaching the top surface to an adjacent base surface; the top surface has the same diameter as the adjacent base surface; and
at least two of the at least three truncated cones of each main roll are disposed between the first protrusion portion and the second end portion, and at least two of the at least three truncated cones of each auxiliary roll are disposed between the second protrusion portion and the fourth end portion.
4. The rolling mechanism of claim 3, wherein each truncated cone has a roll surface angle ranging from 2.5° to 5°.
5. The rolling mechanism of claim 3, wherein
the at least three truncated cones of each main roll comprise a first truncated cone and a second truncated cone arranged from the first end portion to the second end portion; the first protrusion portion is formed between the first truncated cone and the second truncated cone; and
the at least three truncated cones of each auxiliary roll comprise a third truncated cone and a fourth truncated cone arranged from the third end portion to the fourth end portion; the second protrusion portion is formed between the third truncated cone and the fourth truncated cone.
6. The rolling mechanism of claim 5, wherein
a ratio of a length of each main roll to a diameter of the first protrusion portion ranges from 3 to 7; and/or a ratio of a diameter of the first protrusion portion to a diameter of the second protrusion portion ranges from 1 to 2.
7. A method for rolling an ultra-fine-grained M50NiL rod by using the rolling mechanism of claim 1, the method comprising:
S1. preparing an M50NiL rod with a diameter ranging from 220 mm to 350 mm as a billet;
S2. heating the billet within a preset time at a preset temperature;
S3. feeding the billet into the rolling mechanism to obtain a semi-finished product; and
S4. cooling the semi-finished product to obtain the ultra-fine-grained M50NiL rod;
wherein
an entry angle of the rolling mechanism ranges from 10° to 13°; and a nip angle of the rolling mechanism ranges from 7° to 10°.
8. The method of claim 7, wherein S3 further comprises: S3-1: feeding the heated billet through a feed inlet adjacent to the two second end portions into the nip zone for rolling, and forcing the semi-finished product to move through a feed outlet adjacent to the two fourth end portions.
9. The method of claim 8, wherein
the two main rolls have the same shape as the two auxiliary rolls; the two main rolls and the two auxiliary rolls separately comprise at least three truncated cones arranged along a corresponding roll axis; at least two of the at least three truncated cones of each main roll are disposed between the first protrusion portion and the second end portion, and at least two of the at least three truncated cones of each auxiliary roll are disposed between the second protrusion portion and the fourth end portion; for each main roll, a first truncated cone and a second truncated cone among the at least three truncated cones of the main roll are arranged from the first end portion to the second end portion; the first protrusion portion is formed between the first truncated cone and the second truncated cone; for each auxiliary roll, a third truncated cone and a fourth truncated cone among the at least three truncated cones of the auxiliary roll are arranged from the third end portion to the fourth end portion; the second protrusion portion is formed between the third truncated cone and the fourth truncated cone; distances between the two main rolls and between the two auxiliary rolls are adjustable; and S3 further comprises:
S3-2. adjusting the distances between the two main rolls and between the two auxiliary rolls; either feeding the heated billet through the feed inlet adjacent to the two second end portions into the nip zone for rolling and forcing the semi-finished product to move through the feed outlet adjacent to the two fourth end portions, or feeding the heated billet through a feed inlet adjacent to the two fourth end portions into the nip zone for rolling and forcing the semi-finished product to move through a feed outlet adjacent to the two second end portions; and
S3-3. repeating S3-2.
10. The method of claim 9, wherein the two main rolls and the two auxiliary rolls rotate at a speed ranging from 11 r/min to 13 r/min.
11. The method of claim 7, wherein a ratio of a diameter of the first protrusion portion to a diameter of the billet ranges from 1 to 5....

Claims

CLAIM
1. The ornamental design for an electronic hookah as shown and described....

Claims

What is claimed is:
1. A travel pillow, comprising:
a mounting assembly; and
a main body comprising a U-shaped case detachably connected to the mounting assembly;
wherein:
the mounting assembly comprises a cover, a U-shaped filler, and an inner frame; the cover, the U-shaped filler, and the inner frame are disposed sequentially from outside to inside; and the U-shaped filler is detachably attached to the U-shaped case;
the inner frame comprises an arc-shaped support body and two arms;
two ends of the arc-shaped support body comprise two first knuckles, respectively; and the travel pillow further comprises two rotary connectors connected to the two first knuckles, respectively;
each arm comprises a second knuckle; the first knuckle comprises a through hole; each rotary connector comprises a rotating shaft and a nut;
the rotating shaft comprises a threaded end and a rotating part;
the threaded end is in threaded connection to the nut; and the rotating shaft is disposed in the through hole;
the first knuckle is disposed between the nut and the second knuckle;
and the rotating part is disposed in the second knuckle; and
the two arms are rotatably disposed on both ends of the arc-shaped support body, respectively; and an included angle between the arc-shaped support body and each arm is adjustable.
2. The travel pillow of claim 1, wherein the mounting assembly is U-shaped and comprises an inner surface in contact with the U-shaped case; and the U-shaped case comprises an outer surface fitting in with the inner surface.
3. The travel pillow of claim 1, wherein the cover comprises an arc-shaped middle and two end parts; and the two end parts are formed integrally with or detachably connected to the arc-shaped middle.
4. The travel pillow of claim 1, wherein the U-shaped filler is detachably connected to the U-shaped case through a zipper; and the U-shaped filler comprises silicone or rubber.
5. The travel pillow of claim 1, wherein the U-shaped filler comprises a first groove; the arc-shaped support body comprises a first protrusion; and the first groove is detachably connected to the first protrusion.
6. The travel pillow of claim 5, wherein the U-shaped filler further comprises a second groove; each of the two arms comprises a second protrusion; and the second protrusion is detachably disposed in the second groove....

Claims

What is claimed is:
1. A travel pillow, comprising:
a main body;
a rotary frame disposed on an outer side of the main body; and
a casing detachably disposed on an outer side of the rotary frame;
wherein:
the rotary frame comprises a support arm, a rear support part, and an angle adjustment assembly; the support arm is rotatably connected to the rear support part, and the angle adjustment assembly is disposed between the support arm and the rear support part to adjust an angle between the support arm and the rear support part;
the angle adjustment assembly comprises a rotating shaft and a damper; the damper sleeves one end of the rotating shaft; the damper comprises a first fixing part and an adjustment end; the adjustment end comprises a plurality of adjustment sections disposed at equal intervals around the rotating shaft; each of the adjustment sections comprises a first adjustment section and a second adjustment section; the first adjustment section is closer to the first fixing part than the second adjustment section; and the first adjustment section has a greater outer diameter than the second adjustment section;
the support arm comprises a first socket ring, and the rear support part comprises a second socket ring; the first socket ring is connected to the support arm and sleeves the rotating shaft; and the second socket ring is connected to the rear support part and sleeves the rotating shaft; and
the rotating shaft comprises a second fixing part and a damping part which are disposed on both ends of the rotating shaft, respectively; the damper is detachably disposed around the damping part so as to rotate around the damping part; and the second fixing part comprises an external thread matched with a threaded nut.
2. The travel pillow of claim 1, wherein the damper further comprises a damping cover comprising an internal thread; and the first fixing part comprises an external thread matched with the internal thread.
3. The travel pillow of claim 1, wherein the second fixing part has an irregular shape; the second socket ring comprises a connection part matched with the second fixing part in shape; and the connection part sleeves the second fixing part.
4. The travel pillow of claim 1, wherein the second socket ring further comprises a first ring part and a second ring part; the rotating shaft is inserted through the second ring part, the first socket ring, and the second ring part successively, and is fixedly disposed to prevent the first socket ring from sliding off the rotating shaft.
5. The travel pillow of claim 1, wherein the travel pillow comprises a filler disposed between the rotary frame and the casing; and the filler comprises silicone....

Claims

CLAIM
1. The ornamental design for a storage shelf as shown and described....