Claims

What is claimed is:
1. An insecticidal gun, comprising:
a gun body;
a feeding member;
a percussion member;
a trigger; and
an electric drive mechanism;
wherein:
the gun body comprises a launching chamber; the feeding member is slidably connected to the gun body and comprises a material storage chamber configured to communicate with the launching chamber;
the electric drive mechanism is configured to drive the percussion member to move in the launching chamber;
when the percussion member is driven by the electric drive mechanism to move, the feeding member moves along an axial direction of the gun body, so that the material storage chamber communicates with the launching chamber intermittently; and
the trigger is rotatable with respect to the gun body to activate or inactivate the electric drive mechanism.
2. The gun of claim 1, wherein the percussion member comprises a rack extending along the axial direction of the gun body; the electric drive mechanism comprises a motor disposed on the gun body and a gear set driven by the motor; and the gear set comprises a driving gear meshed with the rack.
3. The gun of claim 2, wherein the driving gear comprises a cam; the feeding member comprises a connecting rod extending to one side of the cam; when in use, the electric drive mechanism drives the percussion member to move, the cam leans against the connection rod to drive the feeding member on the gun body, and the material storage chamber communicates with the launching chamber; and
the insecticidal gun further comprises an elastic member disposed on one side of the feeding member and sleeving the gun body; when the cam is separated from the connection rod, the elastic member drives the feeding member to move, and the material storage chamber is disconnected with the launching chamber.
4. The gun of claim 3, wherein the feeding member comprises a storage member sleeving the gun body; the storage member comprises an accommodation space and the elastic member is disposed in the accommodation space.
5. The gun of claim 4, wherein a cross-section of the material storage chamber gradually increases in a direction away from the gun body.
6. The gun of claim 3, wherein the gun body further a guide groove, and the connecting rod is slidable in the guide groove.
7. The gun of claim 2, wherein the driving gear comprises a stop part; the trigger comprises a switching member disposed on one side of the stop part; the switching member is movable along the axial direction of the gun body to change between a single firing position and a continuous firing position; the trigger further comprises a firing seat configured to pushing against or detach from the switch; when the switching member is in a single firing position, the stop part abuts against the switching member and the firing seat detaches from the switch; the switching member comprises an active part abutting against the stop part; when moving to a continuous firing position, the switching member pushes the active part to move and release the stop part.
8. The gun of claim 1, wherein the gun body comprises a switch electrically connected to the electric drive mechanism on one side of the trigger; when rotating relative to the gun body, the trigger presses or releases the switch to open or close the electric drive mechanism.
9. The gun of claim 1, wherein the percussion member comprises one end extending into the launching chamber, and a seal ring is disposed on an outer wall of the end....

Claims

What is claimed is:
1. A method for promoting expression of a foreign gene in a plant, the method comprising: constructing a recombinant vector comprising a foreign gene operably linked to a soybean gene promoter pRPS28 or an intron-comprising soybean gene promoter pRPS28-I, and introducing the recombinant vector into the plant; the promoter pRPS28 being represented by SEQ ID NO: 2, and the intron-comprising promoter pRPS28-I being represented by SEQ ID NO: 3.
2. The method of claim 1, wherein the foreign gene is a beta-glucuronidase (GUS) gene.
3. The method of claim 1, wherein the plant is soybean, and the expression of the foreign gene occurs in cotyledons, radicles, plumules, true leaves, compound leaves, buds, petioles, internodes, roots and root nodules of the soybean.
4. The method of claim 1, wherein the plant is Arabidopsis, and the expression of the foreign gene occurs in whole plant, flower and pod of the Arabidopsis.
5. The method of claim 1, wherein the plant is tobacco, and the expression of the foreign gene occurs in leaves of the tobacco.
6. A method for preparing a recombinant vector comprising a soybean gene promoter, the method comprising inserting a soybean gene promoter pRPS28 or pRPS28-I into a vector pCAMBIA1391Z-BAR, wherein inserting the soybean gene promoter pRPS28 or pRPS28-I into the vector pCAMBIA1391Z-BAR comprises using a PCR amplification fragment of pRPS28 or pRPS28-I as a template, and cloning the PCR amplification fragment into a soybean stable transformation vector pCAMBIA1391Z-BAR by a seamless cloning method to obtain a soybean stable transformation vector pRPS28-GUS-BAR or pRPS28-I-GUS-BAR; wherein:
the vector pCAMBIA1391Z-BAR is obtained by linearizing a vector pCAMBIA1391Z with a restriction enzyme XhoI, and replacing a gene HygR with a gene BAR by the seamless cloning method;
the recombinant vector pRPS28-GUS-BAR is amplified using the following primers:
pRPS28-GUS-BAR-F:
(SEQ ID NO: 14)
GACCATGATTACGCCAAGCTTCACCACCCAATCCATAACCACCAC;
pRPS28-GUS-BAR-R:
(SEQ ID NO: 13)
CCAGTGAATTCCCGGGGATCCCTGATGCAAAACACGAACAAAGAAAG;
the recombinant vector pRPS28-I-GUS-BAR is amplified using the following primers:
pRPS28-I-GUS-BAR-F:
(SEQ ID NO: 14)
GACCATGATTACGCCAAGCTTCACCACCCAATCCATAACCACCAC;
pRPS28-I-GUS-BAR-R:
(SEQ ID NO: 15)
CCAGTGAATTCCCGGGGATCC CCTGCTCAAACACAATCAACAG; and
the promoter pRPS28 has the nucleotide sequence of SEQ ID NO: 2, and the promoter pRPS28-I has the nucleotide sequence of SEQ ID NO: 3....

Claims

What is claimed is:
1. An electronic control actuator, comprising:
a lower housing and an upper housing, the lower housing or the upper housing comprising a plurality of first matching holes, and the lower housing and the upper housing cooperating to form an installation space;
an isolation plate disposed between the lower housing and the upper housing, the isolation plate comprising a plurality of second matching holes, and a plurality of locating pins respectively passing through the plurality of first matching holes and the plurality of second matching holes; and
a compact gear assembly and a drive motor both disposed in the installation space, and the compact gear assembly being cooperatively connected to the drive motor;
wherein:
the compact gear assembly comprises:
a first reduction gear, in transmission connection to a motor shaft of the drive motor at a first location;
a second reduction gear, fixedly coaxially connected to the first reduction gear; and
a sector gear, the sector gear being meshed with the second reduction gear at a second location; the sector gear being coaxially rotationally connected to an output shaft; and the sector gear comprising a matching groove;
the motor shaft extends through the matching groove in the sector gear; the second reduction gear is disposed between the drive motor and the first reduction gear; whereby both the second reduction gear and the sector gear are disposed between the drive motor and the first reduction gear; and the second location is disposed adjacent to the drive motor with respect to the first location along an axial direction of the motor shaft;
the lower housing comprises a limiting part disposed on one side of the locating pins away from the first matching holes; the limiting part comprises a support surface, and when the lower housing is cooperatively connected to the upper housing, the support surface abuts against one side of the isolation plate away from the first matching holes; and
the lower housing comprises a side wall, a motor-mounting part, an air-cooled element, and a water-cooled element; the motor-mounting part is disposed in a middle of the side wall; the air-cooled element is disposed around the motor-mounting part; the water-cooled element is disposed in the side wall and corresponds to the air-cooled part; and the water-cooled element is disposed around the motor-mounting part.
2. The electronic control actuator of claim 1, wherein the first matching holes are two in number, and are disposed along a diagonal of the lower housing or the upper housing.
3. The electronic control actuator of claim 1, wherein the matching groove is an arc-shaped structure, and a distance between a motion trajectory of the motor shaft within the arc-shaped structure and a root circle of the sector gear is constant.
4. The electronic control actuator of claim 3, further comprising:
the output shaft, disposed on the upper housing and coaxially rotationally connected to the sector gear;
a locating part sleeving the output shaft; and
an elastic member sleeving the output shaft, the elastic member comprising a first end and a second end opposite to the first end, and the first end being connected to the locating part, and the second end being cooperatively connected to the upper housing.
5. The electronic control actuator of claim 4, wherein one side of the locating part facing the elastic member comprises a first groove, and the first end is cooperatively limited in the first groove; the upper housing comprises a second groove, and the second end is cooperatively limited in the second groove; and the locating part is rotatable along with the rotation of the output shaft.
6. An exhaust gas treatment system, comprising the electronic control actuator of claim 1.
7. The system of claim 6, further comprising an exhaust gas circulation pipeline and a valve disposed on the exhaust gas circulation pipeline, wherein the electronic control actuator is configured to control the opening or closing of the valve.
8. A vehicle, comprising the exhaust gas treatment system of claim 6....

Claims

What is claimed is:
1. A supporting device for a punching bag, comprising:
1) a hollow tubular pillar;
2) a connector;
3) a flange body;
4) a rubber shock absorber; and
5) a support tray;
wherein:
the connector is tubular, and comprises a first end and a second end; the second end is bigger than the first end in diameter; the first end is disposed into the hollow tubular pillar; the connector comprises a first connection hole, and the hollow tubular pillar comprises a second connection hole; the connector and the hollow tubular pillar are fixed by a locking screw through the first connection hole and the second connection hole;
the flange body comprises a central blind hole, and the second end of the connector is disposed into the central blind hole;
the flange body further comprises a radial base; a circumference of the radial base comprises a plurality of mounting holes configured to receive a counterweight unit to stabilize the supporting device;
the support tray is a disc structure, comprising at least two support rods; one end of each support rod is fixed to the hollow tubular pillar, and the other end is fixed to the support tray; and the support tray is configured to support a punching bag body; and
the rubber shock absorber comprises a central hole; the hollow tubular pillar is disposed through the central hole; and the rubber shock absorber is disposed below and leans against the support tray.
2. The device of claim 1, wherein a periphery of the support tray is bent upwards by 90 degrees to form a smooth contact surface.
3. The device of claim 1, wherein the first end of the connector is a shrinking end towards the hollow tubular pillar thus facilitating a connection between the connector and the hollow tubular pillar.
4. The device of claim 1, wherein a step is disposed in the central blind hole of the flange body to divide the central blind hole into a first part and a second part, and a size of the first part is larger than that of the second part; the locking screw is located in the first part and supported by the step, and the second end of the connector is firmly fixed in the second part....

Claims

What is claimed is:
1. A power amplifier, comprising:
1) a preamplifier circuit, the preamplifier circuit comprising a first DC blocking capacitor C1, a first decoupling capacitor C2, a second decoupling capacitor C3, a stabilizing resistor Rill, a first AC blocking resistor RG1, a first input inductor L1, a second input inductor L2, an output inductor L3, a first input microstrip line MLIN1, a second input microstrip line MLIN2, an output microstrip line MLIN3, and a first transistor Q1; and
2) a post amplifier circuit, the post amplifier circuit comprising a first gate microstrip line MLIN4, a second gate microstrip line MLIN5, a third gate microstrip line MLIN6, a fourth gate microstrip line MLIN7, a drain inductor L4, a first drain microstrip line MLIN8, a second drain microstrip line MLIN9, a second AC blocking resistor RG2, a third decoupling capacitor C5, a fourth decoupling capacitor C6, a third DC blocking capacitor C7, an AC blocking inductor L5, a second transistor Q2, a third transistor Q3, and a fourth transistor Q4;
wherein:
a first end of the first DC blocking capacitor C1 acts as an input terminal of the preamplifier circuit, and a second end of the first DC blocking capacitor C1 is connected to the stabilizing resistor Rin, the first input inductor L1, the first input microstrip line MLIN1, and a gate electrode of the first transistor Q1 sequentially;
a first end of the first decoupling capacitor C2 is grounded, and a second end of the first decoupling capacitor C2 is connected to the first AC blocking resistor RG1, the second input inductor L2, the second input microstrip line MLIN2, and the gate electrode of the first transistor Q1 sequentially;
a junction of the first decoupling capacitor C2 and the first AC blocking resistor RG1 is connected to a gate supply voltage Vgs1;
a first end of the second decoupling capacitor C3 is grounded, and a second end of the second decoupling capacitor C3 is connected to the output inductor L3, the output microstrip line MLIN3, and a drain electrode of the first transistor Q1; a junction of the second decoupling capacitor C3 and the output inductor L3 is connected to a drain supply voltage Vds1; and a junction of the output inductor L3 and the output microstrip line MLIN3 acts as an output terminal of the preamplifier circuit;
a second DC blocking capacitor C4 is disposed between the preamplifier circuit and the post amplifier circuit;
a first end of the first gate microstrip line MLIN4 acts as an input terminal of the post amplifier circuit, and a second end of the first gate microstrip line MLIN4 is connected to the second gate microstrip line MLIN5, the third gate microstrip line MLIN6, the fourth gate microstrip line MLIN7, the second AC blocking resistor RG2, and the third decoupling capacitor C5 sequentially; and one end of the third decoupling capacitor C5 is grounded;
a junction of the second AC blocking resistor RG2 and the third decoupling capacitor C5 is connected to a gate supply voltage Vgs2; a junction of first gate microstrip line MLIN4 and the second gate microstrip line MLIN5 is connected to a gate electrode of the second transistor Q2; a junction of the second gate microstrip line MLIN5 and the third gate microstrip line MLIN6 is connected to a gate electrode of the third transistor Q3; a junction of the third gate microstrip line MLIN6 and the fourth gate microstrip line MLIN7 is connected to a gate electrode of the fourth transistor Q4;
the drain inductor L4 is disposed between drain electrodes of the second transistor Q2 and the third transistor Q3;
the first drain microstrip line MLIN8 is disposed between drain electrodes of the third transistor Q3 and the fourth transistor Q4; and
a junction of the first drain microstrip line MLIN8 and the fourth transistor Q4 is connected to a first end of the second drain microstrip line MLIN9; a second end of the second drain microstrip line MLIN9 is connected to first ends of the fourth decoupling capacitor C6, the AC blocking inductor L5, and the third DC blocking capacitor C7; a second end of the fourth decoupling capacitor C6 is grounded; a second end of the AC blocking inductor L5 is connected to a voltage source Vds2; and a second end of the third DC blocking capacitor C7 acts as an output terminal of the post amplifier circuit....

Claims

What is claimed is:
1. A lidar system, comprising:
a laser;
an optical detector;
a laser antenna; and
a silicon-based integrated magneto-optical circulator comprising an input port, a receiving port, and an emission port;
wherein:
the silicon-based integrated magneto-optical circulator comprises a silicon-based integrated Mach-Zehnder interference structure or a silicon-based integrated micro-ring structure, and a plurality of silicon-based integrated magneto-optical waveguides;
the laser is aligned and coupled to the input port of the silicon-based integrated magneto-optical circulator via an optical fiber, a grating coupler, or an edge coupler;
the optical detector is aligned and coupled to the receiving port of the silicon-based integrated magneto-optical circulator via the optical fiber, the grating coupler, or the edge coupler;
the laser antenna is aligned and coupled to the emission port of the silicon-based integrated magneto-optical circulator via the optical fiber, the grating coupler, or the edge coupler; the laser is configured to generate a laser light transmitting to the laser antenna via the silicon-based integrated magneto-optical circulator; the laser antenna is configured to collimate the laser light, compress the divergence angle of the laser light, and emits the compressed laser light; moreover, the laser antenna is also configured to receive the reflected light of a detected object;
when the lidar system is used, the input port of the silicon-based integrated magneto-optical circulator is configured to receive a detection signal generated by the laser; the detection signal enters the laser antenna through the silicon-based integrated magneto-optical circulator for single-channel emission, and is reflected by the detected object, thereby generating a reflected signal; the reflected signal is received by the laser antenna, returns to the silicon-based integrated magneto-optical circulator through the emission port, and then returns to the optical detector connected to the receiving port of the silicon-based integrated magneto-optical circulator from another channel, to run in a full-duplex mode; and
the silicon-based integrated Mach-Zehnder interference structure comprises two interference arms, and the plurality of silicon-based integrated magneto-optical waveguides comprise 180° curved waveguides to steer a light to an opposite direction;
a reciprocal phase difference between the two interference arms is an odd multiple of π/2; and a non-reciprocal phase difference between the two interference arms is set to be π/2 by configuring the length of each silicon-based integrated magneto-optical waveguide;
one of the two interference arms is adapted to unidirectionally transmit light in a forward direction, and the other one of the two interference arms is adapted to unidirectionally transmit light in a backward direction; and when in use, the light transmitted in the forward direction and the light transmitted in the backward direction are separated from each other.
2. The lidar system of claim 1, wherein:
the silicon-based integrated Mach-Zehnder interference structure further comprises a light splitting part, a light combining part, four ports, and two edges; the light splitting part and the light combining part, respectively, comprises two integrated 3 dB couplers; two of the four ports are disposed at one edge and the remaining two ports are disposed at another edge; the two ports at one edge are respectively used as the input port and the receiving port of the silicon-based integrated magneto-optical circulator; one of the two ports at another edge isolated from the input port is suspended, and the remaining port is used as the emission port of the silicon-based integrated magneto-optical circulator.
3. The lidar system of claim 1, wherein:
the silicon-based integrated micro-ring structure comprises two silicon-based integrated straight waveguides and a silicon-based integrated ring optical waveguide; the two silicon-based integrated straight waveguides are disposed parallel to each other, and the silicon-based integrated ring optical waveguide is disposed between the two silicon-based integrated straight waveguides; the silicon-based integrated ring optical waveguide is circular or racetrack-shaped; the silicon-based integrated magneto-optical waveguides are disposed in the silicon-based integrated ring waveguide; and
the silicon-based integrated micro-ring structure comprises four ports and two edges, in which two ports are disposed at one edge and the remaining two ports are disposed at another edge; the two ports on one edge are respectively used as the input port of the silicon-based integrated magneto-optical circulator and the emission port of the silicon-based integrated magneto-optical circulator; one of the two ports at another edge disposed in the same silicon-based integrated straight waveguide as the emission port of the silicon-based integrated magneto-optical circulator is used as the receiving port; and the remaining port at another edge is suspended.
4. The lidar system of claim 1, wherein the laser antenna is a phased array laser antenna....

Claims

What is claimed is:
1. A pipeline, comprising:
a pipeline body:
a sealing member; and
a sleeve;
wherein:
the pipeline body comprises a connection end; the connection end comprises a first section and a second section adjacent to the first section; and the first section comprises an end face perpendicular to an axis of the pipeline body;
the sealing member comprises a first annular part and a second annular part; the first annular part and the second annular part are disposed coaxially; the second annular part comprises a first surface oriented toward the first annular part; an axial projection of the first annular part falls within the first surface; the first surface comprises a first region and a second region; the first region is enclosed by the axial projection of the first annular part, and the second region surrounds the axial projection of the first annular part; the first annular part sleeves an outer wall of the first section; and the end face of the first section abuts against the first region;
the sleeve sleeves the second section and the first annular part; and the sleeve comprises an end face abutting against the second region; and
an outer diameter of the second annular part increases and then decreases along the axial direction.
2. The pipeline of claim 1, wherein the sleeve is at least partially connected to the first annular part by a sliding fit.
3. The pipeline of claim 2, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part; an outer diameter of the first annular part gradually decreases from the proximal end to the distal end;
the sleeve comprises a section sleeving the first annular part; and an inner diameter of the section gradually decreases to match the decrease in the outer diameter of the first annular part.
4. The pipeline of claim 2, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part; an outer diameter of the first annular part gradually increases from the proximal end to the distal end;
the sleeve comprises a section sleeving the first annular part; and an inner wall of the section is cylindrical in the shape.
5. The pipeline of claim 1, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part;
an outer diameter of the first annular part gradually decreases from the proximal end to the distal end; the sleeve comprises a section sleeving the first annular part;
and an inner diameter of the section gradually decreases to match the decrease in the outer diameter of the first annular part.
6. The pipeline of claim 1, wherein the first annular part comprises a distal end and a proximal end; the distal end is away from the second annular part, and the proximal end is adjacent to the second annular part;
an outer diameter of the first annular part gradually increases from the proximal end to the distal end; the sleeve comprises a section sleeving the first annular part;
and an inner wall of the section is cylindrical in the shape.
7. The pipeline of claim 1, wherein an inner diameter of the second annular part is 1.05-1.65 times that of the pipeline body.
8. The pipeline of claim 1, wherein the second annular part further comprises a second surface and a side surface; the second surface is opposite to the first surface; the side surface connects the first surface and the second surface; and a smooth transition is formed between the second surface and the side surface.
9. The pipeline of claim 1, wherein the sleeve comprises a first sleeve part and a second sleeve part; the first sleeve part sleeves an outer wall of the second section; the second sleeve part sleeves an outer wall of the first annular part; the sleeve further comprises a first tightening section and/or a second tightening section; the first tightening section is disposed on the first sleeve part; and the second tightening section is disposed on the second sleeve part.
10. A liquid chromatography system, comprising:
the pipeline of claim 8;
a target component, comprising a liquid channel entrance comprising internal threads; and
a pipeline connector comprising a screw;
wherein:
the screw comprises a first through hole; the first through hole comprises a first hole part and a second hole part disposed adjacent to the first hole part; the first hole part has a greater diameter than the second hole part; and a junction of the first hole part and the second hole part forms a first step structure; and
the screw sleeves an outer wall of the pipeline; the sleeve comprises a distal end away from the sealing member; the distal end of the sleeve abuts against the first step structure; and the screw is threaded into the internal threads of the liquid channel entrance.
11. A pipeline, comprising:
a pipeline body;
a sealing member; and
a sleeve;
wherein:
the pipeline body comprises a connection end; the connection end comprises a first section and a second section adjacent to the first section; and the first section comprises an end face perpendicular to an axis of the pipeline body;
the sealing member comprises a first annular part and a second annular part; the first annular part and the second annular part are disposed coaxially; the second annular part comprises a first surface oriented toward the first annular part; an axial projection of the first annular part falls within the first surface; the first surface comprises a first region and a second region; the first region is enclosed by the axial projection of the first annular part, and the second region surrounds the axial projection of the first annular part; the first annular part sleeves an outer wall of the first section; and the end face of the first section abuts against the first region;
the sleeve sleeves the second section and the first annular part; and the sleeve comprises an end face abutting against the second region; and
an outer diameter of the second annular part repeats a pattern of increasing and then decreasing along the axial direction multiple times.
12. A pipeline connector, comprising a screw; wherein:
the screw comprises a first through hole; the first through hole comprises a first hole part and a second hole part disposed adjacent to the first hole part; the first hole part has a greater diameter than the second hole part; and a junction of the first hole part and the second hole part forms a first step structure;
a sidewall of the screw further comprises a first slot communicating with the first through hole; the first slot extends axially through the sidewall of the screw; a width of the first slot, measured in a direction perpendicular to an axis of the first through hole, is smaller than a diameter of the first hole part but equal to or larger than a diameter of the second hole part;
the pipeline connector further comprises a cap detachably connected to the screw; the cap comprises a second through hole and a protrusion; and the protrusion extends axially along the second through hole;
the second through hole and the first through hole are coaxially disposed;
and the protrusion is at least partially inserted into the first slot.
13. The pipeline connector of claim 12, wherein an outer wall of the screw comprises a first wall section and a second wall section;
the first wall section has a smaller diameter than the second wall section; and the first wall section comprises external threads.
14. The pipeline connector of claim 13, wherein a plane where the first step structure is located intersects with the external threads on the first wall section.
15. The pipeline connector of claim 12, wherein the first through hole further comprises a third hole part; one end of the second hole part is away from the first hole part; the third hole part is disposed at the end of the second hole part;
the third hole part has a greater radial cross-sectional area than the second hole part; and a junction of the third hole part and the second hole part forms a second step structure;
an outer wall of the cap comprises a first cap section; an outer diameter of the first cap section matches an inner diameter of the third hole part, so that the first cap section is connected to the third hole part by an interlocking fit.
16. The pipeline connector of claim 15, wherein the outer wall of the cap further comprises a second cap section connected to the first cap section; the first cap section comprises a distal end away from the screw; the second cap section is connected to the distal end of the first cap section; and the second cap section has a greater radial cross-sectional area than the second wall section.
17. The pipeline connector of claim 15, wherein a sidewall of the cap comprises a second slot communicating with the second through hole; the second slot extends axially through the sidewall of the cap; the second slot and the protrusion are disposed alternately in a circumferential direction....

Claims

What is claimed is:
1. A method for preparing (S)-nicotine by reduction, the method comprising:
conducting a reduction process on an alkene compound shown in Formula I and/or an iminium cation compound shown in Formula II
thereby producing (S)-nicotine;
wherein
the reduction process is performed using a biocatalytic method;
the biocatalytic method comprises: in a coenzyme cycling system, catalytically reducing the alkene compound shown in Formula I and/or the iminium cation compound shown in Formula II by an imine reductase, thereby producing (S)-nicotine;
the coenzyme cycling system further comprises a coenzyme, glucose, and glucose dehydrogenase;
the imine reductase comprises an amino acid sequence selected from SEQ ID NOs: 2-4, 6, and 12-22;
the reduction process is carried out within a temperature range of 15 to 45° C.; and
the reduction process is carried out within a pH range of 6.0 to 8.0.
2. The method of claim 1, wherein
the coenzyme comprises NADP salt and/or NAD salt.
3. The method of claim 1, wherein the glucose dehydrogenase comprises an amino acid sequence shown in SEQ ID NO: 1.
4. The method of claim 1, wherein the reduction process is conducted in a buffer solution; and the buffer solution comprises phosphate buffer, Tris-HCl buffer, or TEA-HCl buffer.
5. The method of claim 1, wherein the alkene compound as shown in Formula I or the iminium cation compound as shown in Formula II are prepared by desalination and/or cyclization of a compound as shown in Formula III, or a salt thereof;
6. The method of claim 5, wherein a method for synthesizing the salt of the compound of Formula III comprises:
mixing a compound A with N-methylpyrrolidone and an organic base to yield a compound D; and mixing the compound D with an acid to yield the salt of the compound of Formula III; the reaction equations are as follows:
7. The method of claim 5, wherein a method for synthesizing the salt of the compound of Formula III, and the method comprises:
mixing the compound A with N-methylpyrrolidone and an organic base to form a resultant product; neutralizing the resultant product with an acid to reach a pH of 7-8, thereby yielding a compound B; and mixing the compound B with an acid to produce the salt of the compound of Formula III; the reaction equations are as follows:
8. The method of claim 6, wherein a method for synthesizing the compound A comprises:
mixing nicotinic acid with methanol to form a mixture; and esterifying the mixture in a high acidic environment, thereby yielding the compound A.
9. The method of claim 7, wherein a method for synthesizing the compound A comprises:
mixing nicotinic acid with methanol to form a mixture; and esterifying the mixture in a high acidic environment, thereby yielding the compound A.
10. The method of claim 1, comprising: mixing nicotinic acid with methanol to form a mixture; and esterifying the mixture in a high acidic environment, thereby obtaining a compound A; mixing the compound A with N-methylpyrrolidone and the organic base to yield the compound D, or mixing the compound A with N-methylpyrrolidone and the organic base, and further adding a first acid for neutralization, to yield the compound B; mixing the compound B or the compound D with a second acid, thereby producing the salt of the compound of Formula III; desalting and cyclizing the salt of the compound of Formula III, and reducing a resulting product using a biocatalytic method or a chiral metal catalyst to obtain (S)-nicotine; the reaction equations are as follows:...

Claims

What is claimed is:
1. A crystal form A of a compound of formula Ia:
wherein a CuKα X-ray powder diffraction (XRPD) spectrum of the crystal form A has diffraction peaks at diffraction angle 2θ positions of 6.13°±0.2°, 7.77°±0.2°, 9.43°±0.2°, 10.61°±0.2°, 11.88°±0.2°, 12.44°±0.2°, 12.80°±0.2°, 13.88°±0.2°, 14.28°±0.2°, 14.66°±0.2°, 15.51°±0.2°, 17.09°±0.2°, 17.55°±0.2°, 17.88°±0.2°, 18.95°±0.2°, 21.18°±0.2°, 21.86°±0.2°, 22.40°±0.2°, 22.87°±0.2°, 23.52°±0.2°, 24.93°±0.2°, 25.69°±0.2°, 26.63°±0.2°, 28.60°±0.2° and 30.46°±0.2°.
2. A method for prevention or treatment of AIDS, the method comprising administering to a patient in need thereof a pharmaceutical composition comprising the crystal form A of the compound of formula Ia of claim 1....

Claims

What is claimed is:
1. A method for pre-positioning a rotor of an outdoor fan in a high-speed counter-rotation state before operation, the outdoor fan comprising a permanent-magnet synchronous motor and a wind wheel; the permanent-magnet synchronous motor comprising a motor body and a motor controller; the motor body comprising a stator assembly and a permanent-magnet rotor assembly; the motor controller comprising a microprocessor and an inverter circuit; the inverter circuit comprising a plurality of bridge arms, and each bridge arm comprising an upper bridge arm and a lower bridge arm; each upper bridge arm comprising an upper electronic switching tube, and each lower bridge arm comprising a lower electronic switching tube, the method comprising:
1) during a high-speed counter-operation state, sending, by the microprocessor, a signal to the inverter circuit to turn off all upper electronic switching tubes and turn on all lower electronic switching tubes, thereby achieving a short-circuit brake to reduce a counter-rotation speed of the wind wheel;
2) measuring a phase current of each phase coil winding in the stator assembly;
3) calculating a back electromotive force of each phase coil winding in the stator based on the phase current of each phase coil winding;
4) calculating a position angle θ0 of the rotor assembly based on the back electromotive force of each phase coil winding;
5) checking if the phase current of each phase coil winding is all smaller than a preset threshold current I0; if not, return to 1); if yes, proceed to 6); and
6) calculating a resistance torque to stop the rotor assembly based on the position angle θ0 of the rotor assembly, and then stopping the rotor assembly to achieve pre-positioning before starting.
2. The method of claim 1, wherein the permanent-magnet synchronous motor is a three-phase permanent-magnet synchronous motor, and phase currents flowing through three-phase coil windings are respectively ia, ib, and ic.
3. The method of claim 2, wherein in 2), the phase currents ia, ib, and ic are detected through current sensors or sampling resistors.
4. The method of claim 3, wherein in 3), a reverse electromotive force of each phase coil winding is calculated as follows:
{
e
a
=
(
j
⁢
ω
⁢
L
s
+
R
s
)
⁢
i
a
e
b
=
(
j
⁢
ω
⁢
L
s
+
R
s
)
⁢
i
b
e
c
=
(
j
⁢
ω
⁢
L
s
+
R
s
)
⁢
i
c
;
ea, eb, and ec represent reverse electromotive forces of the three-phase coil windings, respectively; Ls is an inductance of the three-phase coil winding of the stator; Rs is a resistance of the three-phase coil winding of the stator; ω is an electrical angular frequency of the permanent-magnet synchronous motor; and j is a coefficient.
5. The method of claim 4, wherein in 4), the position angle of the rotor assembly is calculated as follows:
performing clark transformation on the reverse electromotive forces ea, eb, and ec to obtain eα and eβ:
{
e
α
=
1
3
⁢
(
2
⁢
e
a
-
e
b
-
e
c
)
e
β
=
3
3
⁢
(
e
b
-
e
c
)
;
calculating an arctangent of eα and eβ to obtain the position angle of the rotor:
θ
0
=
arc
⁢
tan
⁢
(
e
α
e
β
)
.
6. The method of claim 5, wherein in 6), the resistance torque to stop the rotor assembly is calculated by:
Te=is×sin(θis−ω0*t−θe)×1.5×np×φf;
where, is is a current vector on a dq-axis; θis is an angle of the current vector; np is a number of poles of the permanent-magnet synchronous motor; φf is a magnetic flux of the permanent magnet; ω0 is an angular velocity at which the permanent-magnet synchronous motor operates at low speeds; and t is time.
7. The method of claim 6, wherein when θis is equal to θ0, a continuous negative torque is generated during a next half electrical cycle, to stop the rotor in low-speed rotation.
8. The method of claim 7, wherein following 6), the method further comprises 7): running a normal start-up program for the permanent-magnet synchronous motor.
9. The method of claim 8, wherein the normal start-up program comprises providing an initial current for an open-loop control to initiate the rotation of the permanent-magnet synchronous motor, and then switching to a closed-loop control once the permanent-magnet synchronous motor runs at a speed V0.
10. The method of claim 8, wherein the speed V0 is in the range of 300 rpm to 400 rpm....

Claims

What is claimed is:
1. A lumbar support belt, comprising:
a back belt;
a first waist belt;
a second waist belt;
a tightening mechanism;
a first drawstring; and
a second drawstring;
wherein:
the first waist belt and the second waist belt are connected to two ends of the back belt, respectively, and configured to be wrapped around a waist and an abdomen of a user;
the first waist belt and the second waist belt are adjustable in length;
the back belt is a support board being plastic; the support board comprises a first horizontal groove, a second horizontal groove, and a central transversal axis; the first horizontal groove and second horizontal groove extend along a horizontal plane; the central transversal axis extends along a central transversal plane; the central transversal axis and the central transversal plane are substantially perpendicular to the horizontal plane; the first horizontal groove and the second horizontal groove are disposed substantially symmetrically about the central transversal plane;
the first waist belt comprises a first front part and the second waist belt comprises a second front part; the first front part and the second front part are attached to each other to form a compression belt configured for abutting against the abdomen of the user;
the first waist belt comprises a first back part and the second waist belt comprises a second back part; the first back part and the second back part are disposed at a distance from the support board; the first back part and the second back part are connected to the support board through the tightening mechanism; and
the lumbar support belt is configured to be wrapped around the waist, the tightening mechanism is configured to be tightened or loosened to control the support board and the compression belt to press the waist and abdomen;
the tightening mechanism comprises a first connecting plate and a second connecting plate which are of a same shape and have a same curvature as the support board;
the first connecting plate comprises a first fixed end and a first free end;
the first fixed end is connected to one end of the first waist belt; the first connecting plate comprises an inner surface comprising a first sliding block; the first sliding block is disposed into the first horizontal groove and is configured to slide back and forth to drive the first connecting plate to move horizontally with respect to the support board; the first connecting plate further comprises a first group of pulleys;
the second connecting plate comprises a second fixed end and a second free end; the second fixed end is connected to one end of the second waist belt; the second connecting plate comprises an inner surface comprising a second sliding block; the second sliding block is disposed into the second horizontal groove and is configured to slide back and forth to drive the second connecting plate to move horizontally with respect to the support board; the second connecting plate further comprises a second group of pulleys;
the first drawstring and the second drawstring are wrapped around the first group of pulleys and the second group of pulleys; whereby when the first drawstring or the second drawstring is pulled tight, the first connecting plate and the second connecting plate move towards each other;
the first group of pulleys comprises a first upper group of pulleys and a first lower group of pulleys; the first upper group of pulleys and the first lower group of pulleys are disposed on an upper part and a lower part of the first connecting plate, respectively;
the second group of pulleys comprises a second upper group of pulleys and a second lower group of pulleys; the second upper group of pulleys and the second lower group of pulleys are disposed on an upper part and a lower part of the second connecting plate, respectively;
the first drawstring is wrapped around the first upper group of pulleys and the second upper group of pulleys to pull tight or loosen the upper part of the first connecting plate and the upper part of the second connecting plate; whereby the distance between the upper part of the first connecting plate and the upper part of the second connecting plate is adjusted by the first drawstring; and
the second drawstring is wrapped around the first lower group of pulleys and the second lower group of pulleys to pull tight or loosen the lower part of the first connecting plate and the lower part of the second connecting plate; whereby the distance between the lower part of the first connecting plate and the lower part of the second connecting plate is adjusted by the second drawstring.
2. The belt of claim 1, wherein each of the first upper group of pulleys, the first lower group of pulleys, the second upper group of pulleys, and the second lower group of pulleys comprise a first pulley and a second pulley having a smaller diameter than the first pulley; the first pulley and the second pulley are coaxial; an axial line of the first pulley and the second pulley is perpendicular to the direction of motion of the first connecting plate or the second connecting plate; each connecting plate comprises an outer surface and an inner surface; the outer surface protrudes to form a cavity and the cavity extends through the inner surface; a sidewall connecting the inner surface and the outer surface comprises a plurality of notches; the first drawstring or the second drawstring comprises a first end and a second end; and the second end of the first drawstring or the second drawstring passes through at least one of the plurality of notches on the first connecting plate and the second connecting plate so that the first drawstring or the second drawstring is wrapped around the first group of pulleys and the second group of pulleys.
3. The belt of claim 2, wherein the lumbar support belt further comprises a height-adjustable board disposed on the support board; the support board further comprises a plurality of locating holes spaced apart from each other; the height-adjustable board comprises at least one locating block; the at least one locating block is inserted into the plurality of locating holes to adjust a height of the height-adjustable board relative to the support board.
4. The belt of claim 3, wherein the lumbar support belt further comprises a box for receiving; the first drawstring or the second drawstring; the first end of the first drawstring or the second drawstring is secured to the box; the box comprises a bottom surface provided with a hook of a hook-loop fastener; each of the first waist belt and the second waist belt comprises an outer surface provided with a loop of the hook-loop fastener; and the hook of the box is attached to the loop of one of the first waist belt and the second waist belt.
5. The belt of claim 4, wherein the lumbar support belt further comprises a wire hinge disposed on each end of the compression belt to control the tightening mechanism.
6. The belt of claim 5, wherein the support board, the abdominal compression board, and the height-adjustable board each comprise a plurality of vent holes.
7. The belt of claim 6, wherein the support board further comprises an inner surface comprising an airbag cushion.
8. The belt of claim 1, wherein an abdominal compression board is attached to the compression belt.
9. The belt of claim 8, wherein each of the first waist belt and the second waist belt comprises a first part and a second part sewn onto the first part; the first part comprises a first stretch fabric; the second part comprises a second stretch fabric; an elastic deformation of the first stretch fabric is larger than that of the second stretch fabric; and the compression belt employs the second stretch fabric.
10. The belt of claim 9, wherein the lumbar support belt further comprises a belt cutting template used in combination with a pair of scissors to cut an overlong part of the first waist belt and the second waist belt....

Claims

What is claimed is:
1. A foldable file box, comprising:
a plastic sheet, the plastic sheet comprising a bottom wall and two side walls, and the two side walls being foldable relative to the bottom wall to form a U-shaped structure;
two side frames, interlocking with the bottom wall and the two side walls to form a box structure comprising a top opening;
two hanging rods, each hanging rod comprising a bottom portion interlocking with a top part of the plastic sheet and two ends respectively interlocking with the two side frames; and
a top cover, interlocking with the two side frames and the two hanging rods to close the top opening.
2. The foldable file box of claim 1, wherein the two side walls and the bottom wall each comprise a plurality of clasps that are foldable; and the two side frames and the two hanging rods each comprise a plurality of first grooves for respectively interlocking with corresponding clasps.
3. The foldable file box of claim 2, wherein each of the two side frames comprises an inner wall comprising a U-shaped groove; and the two side walls and the bottom wall are embedded into the U-shaped groove.
4. The foldable file box of claim 3, wherein the plurality of clasps are trapezoidal structures disposed on a top portion of each of the two side walls and both ends of the bottom wall; the trapezoidal structures on the two side walls are foldable and interlock with the two hanging rods; and the trapezoidal structures on the bottom wall are foldable and interlock with the two side frames.
5. The foldable file box of claim 4, wherein the trapezoidal structures are bent to an angle of approximately 45° relative to the two side walls or the bottom wall.
6. The foldable file box of claim 2, wherein the plurality of clasps are trapezoidal structures disposed on a top portion of each of the two side walls and both ends of the bottom wall; the trapezoidal structures on the two side walls are foldable and interlock with the two hanging rods; and the trapezoidal structures on the bottom wall are foldable and interlock with the two side frames.
7. The foldable file box of claim 6, wherein the trapezoidal structures are bent to an angle of approximately 45° relative to the two side walls or the bottom wall.
8. The foldable file box of claim 1, wherein both ends of each of the two hanging rods comprise a U-shaped fastener comprising two outward extending walls; and each of the two side frames comprises a second groove matched with the U-shaped fastener.
9. The foldable file box of claim 1, wherein the plastic sheet, the two side frames, the two hanging rods, and the top cover comprise a flexible material.
10. The foldable file box of claim 1, wherein the two hanging rods and the two side frames each comprise a protruding edge through which a folder is hooked on the box structure.
11. The foldable file box of claim 1, wherein each of the two side frames comprises a bottom part and a plurality of wheels pivotally connected to the bottom part.
12. The foldable file box of claim 11, wherein each of the two side frames comprises a plurality of holes; each of the plurality of wheels comprises a bracket that is rotatable; one end of the bracket is disposed into a corresponding hole of each of the two side frames, and the plurality of wheels are detachably connected to the two side frames....

Claims

What is claimed is:
1. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
the seed layer comprises a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component comprises any one or more of Mo, Ti, W, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer; and
a conductive layer is disposed on the seed layer, and the conductive layer comprises Cu.
2. The method for manufacturing the solar cell of claim 1, wherein the first region or/and the second region is/are covered with a tunnel oxide layer and a polysilicon layer.
3. The method for manufacturing the solar cell of claim 1, wherein the seed layer is grown on the solar cell by means of physical vapor deposition.
4. The method for manufacturing the solar cell of claim 3, wherein in step S2, a transparent conductive oxide (TCO) thin film is grown by using a physical vapor deposition method before the seed layer is grown.
5. The method for manufacturing the solar cell of claim 1, wherein when the first region and the second region on the solar cell both exist on a back side of a silicon wafer, the method further comprises:
step S4: after step S3, manufacturing a mask in an electroplated electrode region on the solar cell, etching the solar cell, and forming insulation between electroplated electrodes in the first region and the second region.
6. The method for manufacturing the solar cell of claim 4, wherein when the first region and the second region on the solar cell both exist on a back side of a silicon wafer, between step S2 and step S3, the method further comprises: forming a mask on the seed layer.
7. The method for manufacturing the solar cell of claim 6, wherein after step S3, the method further comprises: removing the mask layer on the seed layer, and then performing wet chemical etching to remove the seed layer.
8. The method for manufacturing the solar cell of claim 7, wherein the TCO thin film is removed during performing wet chemical etching to remove the seed layer.
9. The method for manufacturing the solar cell of claim 1, wherein when the first region and the second region on the solar cell both exist on a back side of a silicon wafer, after step S2, the method further comprises:
step B1: forming a mask on the seed layer, and then performing wet chemical etching to realize insulation between a first portion of the seed layer in the first region and a second portion of the seed layer in the second region; and
step B2: removing the mask on the seed layer.
10. The method for manufacturing the solar cell of claim 1, wherein the solar cell where an electrode is to be disposed is manufactured by using the following steps:
step L1: texturing a surface of a silicon wafer;
step L2: depositing a tunnel oxide layer on a back side of the silicon wafer, and then depositing first doped polysilicon having a first polarity on the tunnel oxide layer;
step L3: depositing a first mask on the first doped polysilicon;
step L4: retaining the first mask predisposed in the first region on the back side of the silicon wafer, and removing the first mask predisposed in the second region on the back side of the silicon wafer;
step L5: removing the first doped polysilicon and the tunnel oxide layer deposited in the second region, and then manufacturing a second mask in the second region;
step L6: depositing the tunnel oxide layer in the second region, and then depositing second doped polysilicon having a second polarity on the tunnel oxide layer in the second region;
step L7: manufacturing a third mask on the second doped polysilicon deposited in the second region;
step L8: retaining the third mask in a non-gap region in the second region, and removing the third mask outside a gap region in the second region;
step L9: removing, by using a wet chemical method, the tunnel oxide layer and the second doped polysilicon deposited in the gap region on the back side of the silicon wafer; and
step L10: performing a double-sided coating on the silicon wafer to obtain the solar cell where the electrode is to be disposed.
11. The method for manufacturing the solar cell of claim 1, wherein the seed layer is formed on the substrate by using physical vapor deposition manufacturing method, or screen printing manufacturing method, or chemical vapor deposition manufacturing method, or electroplating manufacturing method, or chemical plating manufacturing method, or ion plating manufacturing method.
12. The method for manufacturing the solar cell of claim 1, wherein a passivation film is formed between the seed layer and a semiconductor region where an electrode is disposed; and an opening is provided on the passivation film, and the seed layer comes into contact with the semiconductor region through the opening.
13. The method for manufacturing the solar cell of claim 12, wherein a transparent conductive oxide (TCO) thin film is further disposed between the seed layer and the passivation film, and the TCO thin film comes into contact with the semiconductor region through the opening provided on the passivation film.
14. The method for manufacturing the solar cell of claim 13, wherein the TCO thin film is an indium tin oxide or a zinc oxide-based thin film.
15. The method for manufacturing the solar cell of claim 12, wherein the semiconductor region comprises a tunnel oxide layer and doped polysilicon.
16. The method for manufacturing the solar cell of claim 1, wherein a method for growing the conductive layer on the seed layer comprises any of electroplating, physical vapor deposition, screen printing, and chemical plating.
17. The method for manufacturing the solar cell of claim 1, wherein an upper portion of the conductive layer is covered with a protective layer.
18. The method for manufacturing the solar cell of claim 17, wherein the protective layer is an Sn layer or an Ag layer, and the protective layer is grown on the conductive layer by electroplating or chemical plating.
19. The method for manufacturing the solar cell of claim 1, wherein the seed layer is formed by stacking a plurality of sub-seed layers, and contents of the main component in the sub-seed layers stacked decrease along a direction facing away from the substrate.
20. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
a conductive layer is disposed on the seed layer, and the conductive layer consists of Cu; and
the seed layer comprises a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component comprises any one or more of Mo, Ti, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer, thereby providing adhesion of the seed layer to the conductive layer.
21. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
the seed layer comprises a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component comprises any one or more of W, Cr, Mn, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer; and
a conductive layer is disposed on the seed layer, and the conductive layer comprises Cu.
22. A method for manufacturing a solar cell, comprising:
step S1: perforating a film layer in a first region and/or a second region of a solar cell comprising a substrate where an electrode is to be disposed, thus forming a plurality of holes or grooves;
step S2: growing a seed layer on the solar cell, wherein the seed layer comes into conductive contact with the first region and/or the second region through the plurality of holes or grooves in step S1; and
step S3: horizontally transporting a to-be-electroplated solar cell, wherein a cathode electroplating brush is in contact with the seed layer on the horizontally transported solar cell, to form a cathode of an electroplating system on the seed layer, an anode terminal is disposed in an electroplating liquid in an electroplating bath, and a moving mechanism disposed in the electroplating bath drives the solar cell to move from an inlet to an outlet of the moving mechanism of the solar cell, thus achieving electroplating of the solar cell during energization and the horizontal transportation to form an electroplated electrode region comprising electroplated electrodes;
wherein:
the seed layer consists of a main component and an additional component; the main component is Al having a mass content greater than or equal to 70 wt. % of the seed layer, and the additional component is a metal selected from Mo, Ti, W, Cr, Mn, Pd, Bi, Nb, Ta, and Pa; and the additional component has a mass content less than or equal to 30 wt. % of the seed layer; and
a conductive layer is disposed on the seed layer, and the conductive layer comprises Cu....

Claims

The invention claimed is:
1. A heating assembly, comprising a main body and a high-frequency control assembly; wherein:
the main body comprises a heating chamber provided with a first opening;
the main body further comprises a heating element disposed in the heating chamber;
the heating element comprises an elongated sheet and a tube;
one end of the tube is a sealed end, and the other end of the tube is an open end;
the elongated sheet comprises a notch extending along a length of the heating element;
the tube is fixedly disposed in the notch, and the sealed end of the tube abuts against a base of the notch;
the tube comprises a first side wall, a second side wall, and a thermal air chamber surrounded by the first side wall and the second side wall;
the first side wall and the second side wall are convex with respect to the elongated sheet;
each of the first side wall and the second side wall comprises at least one first through hole;
the high-frequency control assembly is disposed outside the heating chamber;
when in use, a tobacco material passes through the first opening and is disposed into the heating chamber; and
when the high-frequency control assembly is energized, an electromagnetic filed is produced, and the heating element produces heat to heat the tobacco material.
2. The heating assembly of claim 1, wherein the high-frequency control assembly comprises a coil and a power supply unit; the coil is configured to produce an electromagnetic field that enables the heating element to produce heat; the power supply unit is electrically connected to the coil to provide alternating current to the coil; the coil is wound into a helix with a hollow space; and the heating chamber is disposed in the hollow space.
3. The heating assembly of claim 2, wherein the power supply unit comprises a battery and a high-frequency control board; the battery is electrically connected to the high-frequency control board to supply power to the high-frequency control board; the high-frequency control board is further electrically connected to the coil and a temperature sensor so as to provide alternating current to the coil and receive information about the temperature changes of the heating element.
4. The heating assembly of claim 3, wherein the main body further comprises a housing and a bracket; the housing comprises a first end provided with a cavity; the bracket is disposed in the housing; the bracket comprises an empty space; and the high-frequency control assembly is disposed in the empty space and the coil is disposed in the cavity.
5. The heating assembly of claim 4, wherein the main body further comprises a cover provided with a first end; the first end is concave to form a first recess; the first recess comprises a first bottom wall provided with a second opening; the cover further comprises an air duct communicating with the second opening; and the air duct extends into the hollow space.
6. The heating assembly of claim 5, wherein the main body further comprises a fixing member configured to hold the tobacco material; one end of the fixing member is concave to form a second recess; the second recess comprises a second bottom wall and the first opening is disposed on the second bottom wall; the fixing member comprises a sliding member disposed in the second recess and slidable along an inner wall of the second recess; the other end of the fixing member is in the form of a necked part which is matched with an inner wall of the first recess in size and shape; the fixing member further comprises a hollow tube communicating with first opening through the necked part; the hollow tube corresponds with the first opening; and the hollow tube functions as the heating chamber.
7. The heating assembly of claim 6, wherein the fixing member is detachably disposed in the cavity; the necked part is disposed into the first recess; the hollow tube is disposed through the second opening into the air duct; and an air channel is formed between an outer wall of the hollow tube and an inner wall of the air duct.
8. The heating assembly of claim 7, wherein the main body further comprises a seal member disposed in one end of the air duct and configured to seal the air channel; the seal member comprises a third recess provided with a second through hole; one end of the heating element is fixedly disposed in the third recess so that the thermal air chamber communicates with the second through hole; and the temperature sensor comprises a conducting wire connected through the second through hole to the high-frequency control board.
9. The heating assembly of claim 1, wherein the heating assembly further comprises a temperature sensor and the thermal air chamber comprises a separate chamber; the temperature sensor is disposed in the separate chamber; the heating element is in an elongated shape; the separate chamber is disposed in the middle of the heating element and extends along the length of the heating element....

Claims

What is claimed is:
1. A heating cup assembly, comprising a first cup;
wherein
the first cup comprises a first cavity, a first side wall, and a second side wall; the first cavity is surrounded by the first side wall; the first side wall comprises a first end and a second end; the second side wall comprises a third end and a fourth end; the second end and the third end are disposed in one horizontal plane; the second side wall is in the shape of a truncated cone, and a diameter of the third end is less than that of the fourth end;
a connecting wall is connected to the second end of the first side wall and the third end of the second side wall;
the heating cup assembly further comprises a second cup detachably disposed in the first cavity; and the second cup comprises a third side wall and a second cavity surrounded by the third side wall;
the third side wall is longer than the first side wall; and
the second side wall extends beyond a top of the second cup.
2. The heating cup assembly of claim 1, wherein the first end is connected to a first bottom wall.
3. The heating cup assembly of claim 2, wherein one end of the third side wall comprises a second bottom wall; and the third side wall and/or the second bottom wall comprises a heating layer.
4. The heating cup assembly of claim 3, wherein the heating layer is disposed in a cavity of the third side wall, and/or is attached to an inner surface of the third side wall and/or an outer surface of the third side wall; and the heating layer comprises metal, carbon nanomaterial, or graphene.
5. The heating cup assembly of claim 1, wherein one end of the third side wall extends radially towards the first cup to form a flange.
6. A hookah, comprising a heater and the heating cup assembly of claim 1; wherein the heating cup assembly is detachably disposed on the heater.
7. The hookah of claim 6, wherein the heater comprises a fourth side wall and a top concave portion surrounded by the fourth side wall; the hookah further comprises a coil wrapped around the fourth side wall; and the heating cup assembly is detachably connected to the top concave portion....

Claims

The invention claimed is:
1. A hookah comprising a heater, at least one elastic support, a first cup, and a second cup, wherein:
the heater comprises a coil, a top part, and a second detachable connector disposed on the top part;
the top part of the heater is concave to form a second concave portion, and the coil is wrapped around a side wall of the second concave portion;
the at least one elastic support is disposed on the top part of the heater;
the second concave portion comprises an outlet and the at least one elastic support is disposed around the outlet;
the first cup is disposed in the second concave portion, and comprises a first cavity:
the second cup comprises a second cavity;
the second cup is disposed in the first cavity so that the first cavity communicates with the second cavity;
the second cup comprises a side wall comprising an inner surface provided with a metal layer;
the first cup is detachably connected to the second concave portion; and the second cup is detachably connected to the first cup; and
the first cup comprises a cup body comprising the first cavity; the cup body comprises a first end and a second end; the first end is closed and the second end is open; the second end of the cup body extends radially outward to form a first flange; and the first flange is disposed on the at least one elastic support.
2. The hookah of claim 1, wherein the second detachable connector comprises a first concave portion and a magnet structure disposed on the top part of the heater; the magnet structure is disposed in the first concave portion; and the heater comprises a curved wall functioning as a handle.
3. The hookah of claim 1, wherein the hookah further comprises a water jar detachably disposed on the top part of the heater; the water jar comprises a jar body provided with a water chamber configured to hold water; the jar body comprises a bottom part provided with a first detachable connector; and the first detachable connector is detachably connected to the second detachable connector.
4. The hookah of claim 3, wherein
the water jar further comprises a side wall and a pipe disposed in the jar body; the pipe comprises a first end and a second end; the pipe is disposed into the water jar with the first end exposed outside the side wall and the second end close to the bottom part of the jar body; the hookah further comprises a smoke collector comprising a water chamber; the first end of the pipe is connected to the smoke collector; the smoke collector comprises a side wall comprising at least one through hole; the pipe communicates with the smoke chamber through the at least one through hole; the first cup comprises a first end and a second end; the first end is closed and the second end is open; the smoke collector further comprises a bottom opening communicating with the second end of the first cup;
the first flange extends axially to form a first side wall in the shape of a truncated cone with a larger opening towards the cup body; the smoke collector further comprises a second side wall in the shape of a truncated cone with a larger end connected to a lower end of the smoke collector; the first side wall is matched with the second side wall in size so that the second side wall is nested in the first side wall; and a lower edge of the second side wall abuts against the first flange;
the jar body further comprises a top portion provide with a hose communicating with the water chamber; the hose comprises an open distal end away from the water chamber and configured for smoke emission; and the hose is inclined relative to the jar body;
the open distal end of the hose extends axially to form a bowl-shaped sleeve to support the mouth of a smoker; the bowl-shaped sleeve comprises a third side wall and a wide opening; and a diameter of the bowl-shaped sleeve decreases from the wide opening to the open distal end of the hose;
the second end of the pipe comprises at least one air outlet;
the water jar further comprises at least one protection pad disposed between the first end of the pipe and the jar body; and
the smoke collector further comprises an open top; the hookah further comprises an air intake disposed in the open top; the air intake comprises an intake body, a first tube, and a second tube; the intake body is disposed in the open top and abuts against the side wall of the smoke collector; the intake body comprises a channel and two openings communicating with the channel; the two openings are disposed on both ends of the intake body; the first tube and the second tube are disposed on both ends of the intake body, respectively, to communicate with the two openings....

Claims

What is claimed is:
1. A method for preparing granules for detecting occult blood in pet urine comprising:
a) weighing 50-70 parts by weight of an adsorbent, 50-60 parts by weight of a filler, 3-5 parts by weight of an antibacterial agent, 5-10 parts by weight of a deodorant, 2-4 parts by weight of cumene hydroperoxide, and 2-4 parts by weight of an indicator as raw materials;
b) pulverizing each component of the raw materials in a);
c) drying the pulverized components obtained in b);
d) mixing the dried components of c) and feeding the mixture into a tablet press machine to granulate the mixture and yield flaky granules; and
e) screening and collecting the flaky granules.
2. The method of claim 1, wherein after being pulverized, each component is screened using a 100-mesh sieve.
3. The method of claim 1, wherein after being pulverized, each component is screened using a 100-mesh sieve.
4. The method of claim 1, wherein the flaky granules have a diameter of 30 mm, and a thickness of 4 mm....

Claims

The invention claimed is:
1. A method for protecting a motor from overheating, the method comprising:
1) running the motor in a given parameter P and detecting a real-time temperature R of the motor;
2) comparing the real-time temperature R with a plurality of set temperatures, the plurality of set temperatures comprising an overheating protection temperature Rm, a shutdown temperature Rmax and a recovery operation temperature Rmin, and Rmin3) according to a comparison result in 2), controlling the motor to operate at an initial current value I0, or operate in a reduced current value with respect to the initial current value I0, or stop running; and
4) when the real-time temperature R meets the condition: Rm2. The method of claim 1, wherein in the overheating protection mode, the current value I varies with the increase of the real-time temperature R according to the following equation: I=I0(1−((R−Rm)/K)), where K is a proportional constant in the range between 1.5×(Rmax−Rm) and 2×(Rmax−Rm).
3. The method of claim 2, wherein in the overheating protection mode, the current value I is updated every a set interval T according to the real-time temperature R of the motor; when a temperature R0 corresponding to a last updated current value I is larger than an immediate real-time temperature R, and R0−R>A, where A is a set constant, which means the motor enters a cooling state, and the motor continues operation at the last updated current value I corresponding to the temperature R0 of the motor.
4. The method of claim 3, wherein when the real-time temperature R meets the condition: Rmin5. The method of claim 4, wherein when the real-time temperature R is greater than or equal to the shutdown temperature Rmax, the motor enters the shutdown model and stops running.
6. The method of claim 5, wherein when the motor stops running, the motor cools down continuously with the time passing by, and the real-time temperature R of the motor decreases continuously, until to the recovery operation temperature Rmin, the current value recovers to the initial current value I0, and the motor restarts to run under the given parameter P.
7. The method of claim 1, wherein at initial startup, when the real-time temperature R is less than the overheating protection temperature Rm, the motor operates normally with the initial current value I0.
8. The method of claim 1, wherein:
1) When the motor starts, if the real-time temperature is R2) During running, if the real-time temperature is Rm3) during running, if the real-time temperature is R>Rmax, the motor stops running until the real-time temperature R decreases to the recovery operation temperature Rmin, and the motor restarts running under the initial current value I0 in the given parameter P;
4) During running, if the real-time temperature is Rmin5) Determining whether the motor is in a shutdown model, if so, allowing the motor to continue resting until the real-time temperature R decreases to the recovery operation temperature Rmin, and then the motor restarts; if not, allowing the motor to run in the initial current value I0.
9. The method of claim 1, wherein the given parameter P is speed or torque or power.
10. The method of claim 1, wherein the motor comprises a motor body, a motor controller, and a temperature detection unit; the motor body comprises a stator assembly and a rotor assembly; the motor controller comprises a control circuit board; the control circuit board comprises a power supply circuit, a motor microprocessor MCU, and an inverter circuit; the power supply circuit supplies power for all circuits, and the motor microprocessor MCU controls the inverter circuit; the inverter circuit controls power on and power off of a coil winding of each phase of the stator assembly thus controlling the motor body; the temperature detection unit is used to detect the real-time temperature R inside the motor body and transmit a detection result to the motor microprocessor MCU; the motor microprocessor MCU compares the real-time temperature R with the plurality of set temperatures so that the motor determines to operate normally with the initial current value I0, or operate in a reduced current value with respect to the initial current value I0, or stop running according to the comparison result....

Claims

What is claimed is:
1. A cell, comprising:
an electrode assembly, the electrode assembly comprising a central hole, at least one positive electrode, at least one negative electrode, and at least one diaphragm separating the at least one positive electrode from the at least one negative electrode; the at least one positive electrode, the at least one negative electrode and the at least one diaphragm being disposed around the central hole in a spiral winding manner; and the central hole having a diameter of greater than 0 and smaller than that of the cell;
a pin assembly, the pin assembly being disposed in the central hole for polarity separation; the pin assembly comprising a housing comprising an axial through hole; the housing being partially or fully disposed in the central hole; the pin assembly further comprising an insulating part for separating a polarity of the cell and at least one electrode lead; the insulating part being disposed in the axial through hole; the at least one electrode lead passing through the insulating part and being connected to the at least one positive electrode or the at least one negative electrode for separating the polarity of the cell; and
a cell house hermetically connected to the housing, thus forming a ring-shaped seal cavity for accommodating the electrode assembly.
2. The cell of claim 1, wherein the housing comprises a tube and a disc-shaped flange extending outwardly from a top of the tube, and the axial through hole is disposed in the tube.
3. The cell of claim 2, wherein the cell house has a U-shaped longitudinal section.
4. The cell of claim 1, wherein the housing comprises a tube and two circular tubes extending outwardly from two ends of a top of the tube, and the axial through hole is disposed in the tube.
5. The cell of claim 4, wherein the cell house is in the shape of a disc.
6. The cell of claim 1, wherein the housing comprises a circular tube, and the axial through hole is disposed in the circular tube.
7. The cell of claim 6, wherein the cell house has a longitudinal section in the shape of a rectangle having a gap in its upper side.
8. The cell of claim 1, wherein the insulating part is partially or fully disposed in the axial through hole of the housing of the pin assembly.
9. The cell of claim 8, wherein the insulating part comprises a columnar part inserted into the axial through hole and an end cap that extends outwardly from a bottom of the columnar part to fully cover a lower end of the axial through hole.
10. The cell of claim 1, wherein the cell further comprises a liquid injection hole through which an electrolyte flows into the cell.
11. The cell of claim 10, wherein the liquid injection hole is disposed on the pin assembly and/or on the cell house.
12. The cell of claim 11, wherein the liquid injection hole is disposed on the insulating part of the pin assembly.
13. The cell of claim 12, wherein the liquid injection hole is sealed with a sealing member to prevent the electrolyte from leaking out through the liquid injection hole.
14. The cell of claim 13, wherein the sealing member adopts one of the following structures:
the sealing member comprises an end cap structure; the end cap structure comprises an end and an embedded part disposed at the lower end of the end; the end covers the axial through hole, and the embedded part is disposed in the axial through hole; and
the sealing member comprises at least one steel ball; the at least one steel ball is disposed in the liquid injection hole in an interference fit.
15. The cell of claim 1, wherein the cell is a lithium-ion cell and further comprises at least one lithium intercalated electrode.
16. The cell of claim 1, wherein the at least one positive electrode, the at least one negative electrode, and the at least one diaphragm each are in the form of a flat strip.
17. The cell of claim 1, wherein components in the electrode assembly are arranged in the following orders: the negative electrode/the diaphragm/the positive electrode/the diaphragm; or the positive electrode/the diaphragm/the negative electrode/the diaphragm.
18. The cell of claim 1, wherein the pin assembly and the cell house comprise a waterproof material.
19. The cell of claim 18, wherein the waterproof material is a metal material or a non-metal material.
20. The cell of claim 19, wherein the metal material is stainless steel, aluminum, or aluminum alloy.
21. The cell of claim 19, wherein the non-metal material is ceramic or plastic.
22. The cell of claim 1, wherein the at least one positive electrode or the at least one negative electrode is electrically connected to the at least one electrode lead with one of the following connection modes:
1) a lower end of the at least one electrode lead is soldered to one end of an intermediate conductor, and the other end of the intermediate conductor is soldered to the at least one positive electrode or the at least one negative electrode; and
2) a lower end of the at least one electrode lead is soldered to the at least one positive electrode or the at least one negative electrode.
23. The cell of claim 1, wherein the insulating part comprises polypropylene.
24. The cell of claim 1, wherein the cell has a circular or elliptical cross section....

Claims

What is claimed is:
1. An electromagnetic immunity test system for a numerical control system, the numerical control system comprising a numerical control machine tool comprising a sliding table, and the electromagnetic immunity test system comprising:
1) a data acquisition and control device;
2) a linear module;
3) an electromagnetic disturbance simulator; and
4) an upper computer;
wherein:
the data acquisition and control device is in a data connection to the linear module, the electromagnetic disturbance simulator, and the upper computer;
the linear module comprises a grating ruler; and the linear module is disposed on the numerical control machine tool to measure location data of the sliding table of the numerical control machine tool and transmit the location data to the data acquisition and control device;
the electromagnetic disturbance simulator is configured to generate and transmit an electromagnetic signal to the numerical control system;
the data acquisition and control device is configured to read the location data in real time and transfer the real-time location data to the upper computer; according to the real-time location data and a direction of movement of the grating ruler, the data acquisition and control device controls the electromagnetic disturbance simulator to generate and transmit the electromagnetic signal to the numerical control system;
the upper computer communicates with the data acquisition and control device and is configured to receive the real-time location data, compare data of location, speed, and acceleration of the linear module before and after being exposed to an electromagnetic disturbance, and quantitatively analyze the influence of the electromagnetic disturbance on the performance of the numerical control system through a preset test method;
the data acquisition and control device comprises a grating input interface, a real-time Ethernet interface, a digital output interface, and a field-programmable gate array (FPGA) chip; the FPGA chip is electrically connected to the grating input interface, the real-time Ethernet interface, and the digital output interface; the grating input interface is in a data connection to the grating ruler; the real-time Ethernet interface is in a network connection to the upper computer; and the digital output interface is connected to the electromagnetic disturbance simulator and triggers the electromagnetic disturbance simulator to generate the electromagnetic disturbance to interfere in the numerical control machine tool; and
the FPGA chip comprises an event trigger that triggers the digital output interface according to the real-time location data and the direction of the movement of the grating ruler to regulate an output level thus controlling the electromagnetic disturbance simulator to generate the electromagnetic disturbance to interfere in the numerical control machine tool.
2. The system of claim 1, wherein the data acquisition and control device further comprises an RS-232/RS-485 interface connected to and communicating with the FPGA chip and the electromagnetic disturbance simulator, thus controlling the electromagnetic disturbance simulator to generate the electromagnetic disturbance to interfere in the numerical control machine tool.
3. The system of claim 1, wherein the electromagnetic disturbance simulator is an electrostatic generator, a burst generator, a surge generator, a variable-frequency power supply, or a combination thereof.
4. A method of quantitative test of immunity of a numerical control system using the electromagnetic immunity test system of claim 1, the method comprising:
1) operating the numerical control system in a preset order; acquiring, using the data acquisition and control device, a first cycle of data measured by the grating ruler; and transferring, using the data acquisition and control device, the first cycle of data as a reference data to the upper computer;
2) imposing, using the electromagnetic disturbance simulator, the electromagnetic disturbance on the numerical control machine tool; acquiring, by the data acquisition and control device, a second cycle of data measured by the grating ruler; and transferring, by the data acquisition and control device, the second cycle of data as a comparison data to the upper computer; and
3) comparing, using the upper computer, the reference data with the comparison data; and checking, using the upper computer, whether an offset between the reference data and the comparison data is less than or equal to a given threshold; if so, the numerical control system passes the test of immunity; otherwise, the numerical control system loses the test of immunity.
5. The method of claim 4, wherein 2) is carried out as follows:
when the sliding table reaches a preset location in a moving direction, the event trigger triggers the digital output interface to change an output level, thus controlling the electromagnetic disturbance simulator to impose the electromagnetic disturbance on the numerical control machine tool; and
the data acquisition and control device receives the second cycle of data measured by the grating ruler and transfers the second cycle of data to the upper computer.
6. The method of claim 4, wherein 3) is carried out as follows:
the upper computer uses the reference data to draw first three curves respectively representing first location, speed, and acceleration of the sliding table, and uses the comparison data to draw second three curves respectively representing second location, speed, and acceleration of the sliding table; and the upper computer compares the first and second three curves and checks whether the offset between the reference data and the comparison data is below the given threshold; if so, the numerical control system passes the test of immunity; otherwise, the numerical control system loses the test of immunity....

Claims

What is claimed is:
1. A device for fatigue test, comprising:
a sample support;
a sample-laying part disposed on the sample support; and
a force-applying part disposed on the sample-laying part;
wherein:
the sample-laying part comprises a substrate plate and at least two arms disposed on the substrate plate;
the sample support comprises a bed plate and at least four roller assemblies disposed on the bed plate; each roller assembly comprises a roller, a roller support, and an adjusting bolt; the roller support is disposed on the bed plate; the roller is disposed on the roller support; the adjusting bolt is disposed between the roller and the roller support; and
the sample support further comprises at least one barrier, and both ends of the barrier are connected to two adjacent roller supports, respectively.
2. The device of claim 1, wherein the force-applying part comprises a power part, a connecting shaft, and a press block; one end of the connecting shaft is connected to the power part, and the other end of the connecting shaft is connected to the press block.
3. A method for fatigue test of resin concrete using the device of claim 1, the method comprising:
S10. removing rust from a steel plate;
S20. applying a resin waterproof adhesive on the substrate plate;
S30. pouring resin concrete on the substrate plate to form a test sample;
S40. assembling the device around the resin concrete; and
S50. loading the test sample at a temperature of 60° C. to 90° C. for fatigue test with the device.
4. The method of claim 3, wherein after rust removal, the steel plate has a surface roughness of 50-100 μm and meets a clearness standard Sa2.5.
5. The method of claim 3, wherein a usage amount of the resin waterproof adhesive is 0.1-1.0 kg/m2.
6. The method of claim 3, wherein pouring resin concrete on the substrate plate comprises stirring and laying at least one layer of the resin concrete on the substrate plate.
7. The method of claim 6, wherein pouring resin concrete on the substrate plate comprises:
disposing a detachable concrete mold on the substrate plate whereby a space is formed therebetween;
placing a reinforcing mesh in the space, and spraying the resin waterproof adhesive on the reinforcing mesh; and
pouring the resin concrete into the space.
8. The method of claim 3, wherein loading the test sample employs pneumatic loading, hydraulic loading, or a combination thereof; and the fatigue test is performed under a sinusoidal cyclic loading at a controlled temperature....

Claims

What is claimed is:
1. A back contact structure of a solar cell, comprising:
a first doped region having an opposite polarity to a silicon substrate and a second doped region having a same polarity as the silicon substrate, wherein the first doped region and the second doped region are spaced apart from each other on a back side of the silicon substrate, and a protective region is arranged on the first doped region;
each of the first doped region and the second doped region comprises a first doped layer, a passivation layer, and a second doped layer;
the protective region comprises an insulation layer and a third doped layer having a same polarity as the second doped region;
an isolation region is arranged between the first doped region and the second doped region;
an opening is provided in the protective region, to connect a first conductive layer to the first doped region; and
a height of the first doped region and a height of the second doped region are both greater than a height of the isolation region.
2. The back contact structure according to claim 1, wherein the height of the first doped region is greater than the height of the second doped region.
3. The back contact structure according to claim 1, wherein the passivation layer is a porous structure having the first doped layer and/or the second doped layer in a hole region.
4. The back contact structure according to claim 3, wherein one of the first doped region and the second doped region is a P-type doped region, the other of the first doped region and the second doped region is an N-type doped region, and a thickness of the passivation layer in the P-type doped region is greater than a thickness of the passivation layer in the N-type doped region.
5. The back contact structure according to claim 3, wherein one of the first doped region and the second doped region is a P-type doped region, the other of the first doped region and the second doped region is an N-type doped region, and a hole density of the passivation layer in the P-type doped region is greater than a hole density of the passivation layer in the N-type doped region.
6. The back contact structure according to claim 3, wherein the first doped layer and the second doped layer have a same doping polarity.
7. The back contact structure according to claim 2, wherein a height difference between the first doped region and the second doped region is in a range of 1-8 μm.
8. The back contact structure according to claim 1, wherein a height difference between the second doped region and the isolation region is in a range of 0.5-8 μm.
9. The back contact structure according to claim 3, wherein a pore size of the porous structure is less than 20 μm.
10. The back contact structure according to claim 3, wherein a ratio of an area of the hole region of the porous structure to an overall area of the porous structure is less than 20%.
11. The back contact structure according to claim 3, wherein a thickness of the passivation layer is in a range of 0.5-10 nm.
12. The back contact structure according to claim 1, wherein the passivation layer and/or the insulation layer are/is an oxide layer, a silicon carbide layer, an amorphous silicon layer, or a combination thereof.
13. The back contact structure according to claim 1, wherein a doping concentration of the first doped layer is between a doping concentration of the silicon substrate and a doping concentration of the second doped layer.
14. The back contact structure according to claim 1, wherein a junction depth of the first doped layer is less than 1.5 μm.
15. The back contact structure according to claim 1, wherein the first doped layer is a monocrystalline silicon doped layer doped with a group-III or group-V element.
16. The back contact structure according to claim 1, wherein the second doped layer and/or the third doped layer comprise(s) a polysilicon doped layer, a silicon carbide doped layer, or an amorphous silicon doped layer.
17. The back contact structure according to claim 16, wherein the silicon carbide doped layer in the second doped layer and/or the third doped layer is composed of at least one silicon carbide doped film each having a different refractive index, and the refractive indexes of the silicon carbide doped films sequentially decrease along a direction from the silicon substrate to the outside.
18. The back contact structure according to claim 16, wherein the silicon carbide doped layer in the second doped layer and/or in the third doped layer comprises a hydrogenated silicon carbide doped layer, a conductivity of the hydrogenated silicon carbide doped layer is greater than 0.01 S·cm, and a thickness of the hydrogenated silicon carbide doped layer is greater than 10 nm.
19. The back contact structure according to claim 1, wherein a thickness of the insulation layer is in a range of 5-150 nm.
20. The back contact structure according to claim 1, wherein a thickness of the insulation layer is greater than a thickness of the passivation layer.
21. A solar cell, comprising:
a silicon substrate;
the back contact structure according to claim 1, arranged on a back side of the silicon substrate;
a first dielectric layer, arranged on a front side of the silicon substrate;
a first conductive layer arranged in the first doped region of the back contact structure and a second conductive layer arranged in the second doped region of the back contact structure; and
a second dielectric layer, arranged on the back contact structure and between the first conductive layer and the second conductive layer.
22. The solar cell according to claim 21, wherein the first dielectric layer and the second dielectric layer each are an aluminum oxide layer, a silicon nitride layer, a silicon oxynitride layer, a silicon carbide layer, an amorphous silicon layer, a silicon oxide layer, or a combination thereof.
23. The solar cell according to claim 22, wherein the first dielectric layer and/or the second dielectric layer comprise(s) a combination of the aluminum oxide layer and the silicon carbide layer or a combination of the silicon oxide layer and silicon carbide layer; and
a thickness of the first dielectric layer is greater than 50 nm, and a thickness of the second dielectric layer is greater than 25 nm.
24. The solar cell according to claim 23, wherein a thickness of the aluminum oxide layer or the silicon oxide layer in the first dielectric layer is less than 40 nm, a thickness of the aluminum oxide layer or the silicon oxide layer in the second dielectric layer is less than 25 nm, and a thickness of the silicon carbide layer in the first dielectric layer and/or in the second dielectric layer is greater than 10 nm.
25. The solar cell according to claim 22, wherein the silicon carbide layer in the first dielectric layer and/or in the second dielectric layer is composed of at least one silicon carbide film each having a different refractive index, and the refractive indexes of the silicon carbide doped films sequentially decrease along a direction from the silicon substrate to the outside.
26. The solar cell according to claim 22, wherein a magnesium fluoride layer is further arranged on an outer layer of the first dielectric layer and/or the second dielectric layer.
27. The solar cell according to claim 21, wherein the first conductive layer and the second conductive layer are transparent conductive oxide (TCO) films and/or metal electrodes.
28. The solar cell according to claim 27, wherein the metal electrodes comprise a silver electrode, a copper electrode, an aluminum electrode, a tin-coated copper electrode, or a silver-coated copper electrode.
29. The solar cell according to claim 21, wherein an electric field layer or a floating junction is further arranged between the front side of the silicon substrate and the first dielectric layer.
30. A photovoltaic module, comprising the solar cell according to claim 21.
31. A photovoltaic system, comprising the photovoltaic module according to claim 30....

Claims

The invention claimed is:
1. A three-dimensional fluorescence imaging system comprising single-objective light-sheet microscopy, the system comprising:
an illumination objective;
a scanning lens group for relay;
a galvanometer;
an illumination module; and
a detection module;
wherein:
the scanning lens group comprises a first scanning lens and a second scanning lens; main optical axes of the first scanning lens and the second scanning lens are orthogonal and confocal; a common focus of the first scanning lens and the second scanning lens is disposed on a central part of the galvanometer;
the illumination module is configured to generate an illumination laser beam; the illumination laser beam passes through the scanning lens group and enters a rear pupil plane of the illumination objective, forming a light sheet having an inclination angle α projected onto an excitation plane of a sample to excite fluorescence; the excitation plane is diagonally intersected with a main optical axis of the illumination objective, and an intersection angle of the excitation plane and the main optical axis of the illumination objective is an inclination angle θ of the light sheet;
the fluorescence emitted from the excitation plane of the sample is collected by the illumination objective, enters the scanning lens group in an opposite direction of an illumination light of the illumination module, and reaches the detection module for imaging, thus obtaining a projection of the excitation plane of the sample on an orthogonal plane of the main optical axis of the illumination objective; and
the detection module comprises an area array detector.
2. The system of claim 1, further comprising a sample carrier, wherein the sample carrier comprises an axial feeding system configured to drive the sample to move along an axis of the illumination objective; an axial position of the sample carrier or the illumination objective changes in a stepwise or continuous manner, and during a rotation period T of the galvanometer, an axial displacement L of the sample carrier or the illumination objective satisfies the following inequality:
L
≤
s
*
sin
⁢
θ
;
wherein, s represents a Rayleigh range of the light sheet.
3. The system of claim 1, wherein under the action of the galvanometer, the excitation plane of the sample is scanned in a direction perpendicular to the main optical axis of the illumination objective; after the fluorescence is reversely scanned by the galvanometer, projections of the excitation plane of the sample on the orthogonal plane of the main optical axis of the illumination objective are obtained sequentially at a position of the area array detector of the detection module; and the projections are reconstructed and stacked, to yield a three-dimensional fluorescence image of the sample.
4. The system of claim 2, wherein under the action of the galvanometer, the excitation plane of the sample is scanned in a direction perpendicular to the main optical axis of the illumination objective; after the fluorescence is reversely scanned by the galvanometer, projections of the excitation plane of the sample on the orthogonal plane of the main optical axis of the illumination objective are obtained sequentially at a position of the area array detector of the detection module; and the projections are reconstructed and stacked, to yield a three-dimensional fluorescence image of the sample.
5. The system of claim 3, wherein an angle of the galvanometer is changed stepwise or continuously, so that the excitation plane of the sample is scanned in the direction perpendicular to the main optical axis of the illumination objective, and a displacement d of the excitation plane of the sample corresponding to adjacent projections in the scanning direction satisfies the following condition:
d
∈
[
h
3
⁢
sin
⁢
θ
,
h
2
⁢
sin
⁢
θ
]
wherein, h represents a thickness of the light sheet.
6. The system of claim 4, wherein an angle of the galvanometer is changed stepwise or continuously, so that the excitation plane of the sample is scanned in the direction perpendicular to the main optical axis of the illumination objective, and a displacement d of the excitation plane of the sample corresponding to adjacent projections in the scanning direction satisfies the following condition:
d
∈
[
h
3
⁢
sin
⁢
θ
,
h
2
⁢
sin
⁢
θ
]
wherein, h represents a thickness of the light sheet.
7. The system of claim 1, wherein a first lens is disposed between the scanning lens group and the illumination objective; the first lens is fixed in position relative to the scanning lens group for collimating a fluorescence signal collected by the illumination objective.
8. The system of claim 2, wherein a first lens is disposed between the scanning lens group and the illumination objective; the first lens is fixed in position relative to the scanning lens group for collimating a fluorescence signal collected by the illumination objective.
9. The system of claim 1, wherein the illumination module comprises a collimated laser and a modulator; the modulator comprises a mask plate; the illumination laser beam is modulated by the modulator to form a predetermined light sheet; the predetermined light sheet passes through a dichroic mirror, is merged with a detection light path, and enters the scanning lens group.
10. The system of claim 2, wherein the illumination module comprises a collimated laser and a modulator; the modulator comprises a mask plate; the illumination laser beam is modulated by the modulator to form a predetermined light sheet; the predetermined light sheet passes through a dichroic mirror, is merged with a detection light path, and enters the scanning lens group.
11. The system of claim 9, wherein the thickness of the light sheet is between 0.3 and 5 μm.
12. The system of claim 10, wherein the thickness of the light sheet is between 0.3 and 5 μm.
13. The system of claim 1, wherein the detection module further comprises a second lens, and the area array detector is disposed on a focal plane of the second lens; and the area array detector is configured to obtain the projection of the excitation plane of the sample on the orthogonal plane of the main optical axis of the illumination objective in a time sequence of external control signals.
14. The system of claim 2, wherein the detection module further comprises a second lens, and the area array detector is disposed on a focal plane of the second lens; and the area array detector is configured to obtain the projection of the excitation plane of the sample on the orthogonal plane of the main optical axis of the illumination objective in a time sequence of external control signals.
15. The system of claim 13, further comprising a depth of field extension module disposed between the scanning lens group and the second lens for expanding a depth of field of the light sheet along the axis of an illumination objective.
16. The system of claim 14, further comprising a depth of field extension module disposed between the scanning lens group and the second lens for expanding a depth of field of the light sheet along the axis of an illumination objective.
17. The system of claim 15, wherein the depth of field extension module is a phase modulation mask, a spatial light modulator, an axial prism, or a prism group.
18. The system of claim 16, wherein the depth of field extension module is a phase modulation mask, a spatial light modulator, an axial prism, or a prism group....

Claims

What is claimed is:
1. The motor controller of A motor controller, comprising:
a housing;
a power circuit board; and
a control circuit board;
wherein:
the housing comprises a first mounting platform, a second mounting platform, and a side wall; there is a height difference between the first mounting platform and the second mounting platform;
the first mounting platform is disposed on an upper part of the side wall, and the second mounting platform is disposed on a middle part of the side wall;
the second mounting platform is disposed on one side of the first mounting platform;
the first mounting platform and the side wall form an upper chamber, and the control circuit board and the power circuit board are disposed in the upper chamber; the control circuit board is closer to the first mounting platform than the power circuit board;
the second mounting platform and the side wall form a lower chamber; the lower chamber communicates with the upper chamber;
a rectifier bridge module protrudes from the power circuit board, and is attached to the second mounting platform for heat dissipation;
the second mounting platform comprises a recess; the rectifier bridge module is embedded in the recess for heat dissipation, and is locked on the second mounting platform through a locking device;
the locking device comprises a depression bar and at least two bolts; two ends of the recess are concave to form two gaps, respectively; a bottom surface of the recess in the two gaps comprises two mounting holes; two ends of the depression bar are disposed in the two gaps, respectively, whereby the depression bar presses on the rectifier bridge module; and the at least two bolts pass through the depression bar and fixedly screwed in the two mounting holes on the bottom surface of the recess;
a plurality of insulated gate bipolar transistors (IGBTs) is protruded from an edge of the control circuit board; a plurality of bosses is protruded from an edge of the first mounting platform, and the plurality of IGBTs is respectively attached to the plurality of bosses for heat dissipation; and
an electric reactor is disposed on the second mounting platform and is electrically connected to the power circuit board.
2. The motor controller of claim 1, wherein the electric reactor is disposed below the rectifier bridge module.
3. The motor controller of claim 2, wherein a mounting bracket is disposed on the second mounting platform, and the electric reactor is disposed on the second mounting platform; and the mounting bracket is fixed on the second mounting platform through bolts.
4. The motor controller of claim 3, wherein the second mounting platform comprises a wire outlet.
5. The motor controller of claim 4, wherein the side wall comprises an inner side wall and an outer side wall; a cavity is formed between the inner side wall and the outer side wall; the wire outlet communicates with the cavity and is vertical upwards; the power circuit board comprises a through hole; wire leads of the control circuit board pass through the through hole and lead out via the wire outlet to connect to a load.
6. The motor controller of claim 5, wherein the inner side wall is arc-shaped, and the outer side wall is circular.
7. The motor controller of claim 6, further comprising a cover plate covering an opening of the housing.
8. An outer rotor motor, comprising a motor body and the motor controller of claim 1, wherein:
the motor body comprises a rotating shaft, a stator assembly, an outer rotor and a sleeve base; the sleeve base comprises a base plate and a sleeve protruding upward from a middle of the base plate; both ends of the sleeve are provided with two bearing chambers, respectively; each bearing chamber comprises a bearing;
the rotating shaft is disposed in the sleeve, and both ends of the rotating shaft are respectively supported by bearings in the two bearing chambers;
the stator assembly is disposed around the sleeve; the outer rotor sleeves the stator assembly; a bottom surface of the bottom plate is provided with a plurality of first heat dissipation ribs distributed circumferentially around the rotating shaft; a first air duct is formed between every two adjacent first heat dissipation ribs, and inner ends of all first heat dissipation ribs form a first holding cavity; a fan is embedded in the first holding cavity, and one end of the rotating shaft extends out of the base plate and is connected to the fan in the first holding cavity; and
the motor controller is disposed on the bottom surface of the bottom plate; and the housing comprises an end face attached to lower ends of the plurality of first heat dissipation ribs.
9. The outer rotor motor of claim 8, wherein a plurality of second radiating ribs disposed on the end face and distributed circumferentially around the rotating shaft; a second air duct is formed between every two adjacent second radiating ribs, and inner ends of all second radiating ribs form a second holding cavity; when the motor controller is installed on the bottom surface of the base plate, a bottom of the fan partially extends into the second holding cavity....

Claims

What is claimed is:
1. A device, comprising:
a water atomization assembly, the water atomization assembly comprising a first housing, a water container disposed in the first housing, an ultrasonic atomization module disposed in the first housing to atomize water from the water container;
an essential oil atomization assembly, the essential oil atomization assembly comprising a second housing, an essential oil atomization module disposed in the second housing, and an essential oil container;
a vacuum pump fixedly disposed on a bottom end of the first housing; wherein:
the essential oil atomization module is connected to and disposed above the essential oil container; the essential oil container is at least partially disposed in the second housing;
the first housing comprises an outer wall comprising a recess, and the second housing is fixedly embedded in an upper part of the recess; and
the vacuum pump is connected to the essential oil atomization module to provide compressed air to atomize an essential oil from the essential oil container.
2. The device of claim 1, wherein the second housing comprises an inner side wall and a mounting member protruding from the inner side wall; and the essential oil atomization module is fixed on the mounting member through a screw fastener.
3. The device of claim 2, wherein the mounting member comprises two mounting columns protruding from the second housing; and the essential oil atomization module comprises screw holes corresponding to the two mounting columns in positions and sizes.
4. The device of claim 3, wherein the essential oil atomization module comprises a nozzle, an upper cover, a partition, and a lower cover; the nozzle is disposed on a side wall of the lower cover; the partition is disposed on the lower cover; the partition and the lower cover form an atomization chamber, and the partition and the upper cover form an accommodation chamber; the partition comprises an air channel, and the atomization chamber communicates with the accommodation chamber via the air channel.
5. The device of claim 4, wherein the lower cover comprises a first through hole and a second through hole, both communicating with the atomization chamber; the first through hole is disposed on a lower part of the lower cover; the second housing further comprises a bottom opening; the essential oil container comprises a head passing through the bottom opening of the second housing to communicate with the first through hole; the second through hole is disposed on a side part of the lower cover to receive the nozzle; one end of the nozzle close to the atomization chamber is connected to an air duct, and the compressed air passes through the nozzle and the air duct and enters the atomization chamber; another end of the air duct is provided with and communicates with a straw; the straw extends through the head and into the essential oil container.
6. The device of claim 5, wherein the atomization chamber comprises a first inner wall and a first outer wall; the accommodation chamber comprises a second inner wall and a second outer wall; the first inner wall comprises a step and the partition is supported by the step; the first outer wall comprises a groove and the second outer wall is imbedded in the groove; the second outer wall comprises a protrusion corresponding to the groove in position and shape, and the upper cover is integrated with the lower cover via the cooperation of the protrusion and the groove.
7. The device of claim 6, wherein the partition comprises a main body and a spiral duct disposed in a central part of the main body; the spiral duct comprises a first opening disposed on a top surface of the main body and a second opening disposed on a bottom surface of the main body; and the essential oil atomized in the atomization chamber enters the accommodation chamber through the spiral duct.
8. The device of claim 7, wherein a height of the step is equal to that of an edge of the main body; the partition is disposed on the step, and the edge of the main body abuts against and is flush with the first inner wall of the atomization chamber; the upper cover is connected to the lower cover, and the second inner wall of the accommodation chamber abuts against the edge of the main body and the first inner wall of the atomization chamber to fix the partition.
9. The device of claim 8, wherein the water container comprises a bottom wall provided with a water outlet; the water atomization assembly further comprises a water passage communicating with the water outlet, a vapor passage, and a blower; the ultrasonic atomization module is disposed below the water passage; the blower is fixedly disposed on the bottom end of the first housing and is configured to produce airflow to drive vapor in the vapor passage to flow out.
10. The device of claim 9, wherein a buoy valve is disposed between the water outlet and the water passage; the buoy valve comprises a control valve disposed at the water outlet and a telltale float disposed in the water passage and matched with the control valve.
11. The device of claim 10, wherein the second housing comprises a perfume outlet communicating with the vapor passage, so that atomized essential oil and vapor are premixed in the vapor passage, and then overflow from the vapor outlet into ambient air.
12. The device of claim 1, further comprises a third housing and a control unit disposed in the third housing; wherein the control unit is configured to control a working time and/or working state of the ultrasonic atomization module and the essential oil atomization module; and the third housing is fixedly embedded in a lower part of the recess....

Claims

What is claimed is:
1. An atomization assembly, comprising an atomization cup for heating a tobacco material to produce smoke, and a smoke guiding cup for conveying the smoke from the atomization cup to a smoke filter; wherein:
the atomization cup comprises a cup body, the cup body comprises a first side wall, a first cavity confined by the first side wall, and a through hole;
the first cavity is configured to accommodate the tobacco material;
the through hole is configured to convey the smoke generated by the tobacco material out of the atomization cup into the smoke guiding cup;
the through hole communicates with the first cavity;
the first side wall comprises a heating element made of conductive material, or the first side wall is made of conductive material; and
the smoke guiding cup comprises a support part and a connection part, wherein the support part is configured to receive and support the atomization cup, and the support part comprises a second side wall and a second cavity confined by the second side wall; the connection part is connected to the support part, and is configured to be connected to the smoke filter;
the first side wall is disposed in second cavity;
the atomization cup comprises a first flange, the first flange extends circumferentially and radially out from the outer peripheral surface of one end of the first side wall;
the first flange abuts against one end of the second side wall, whereby the atomization cup is supported by and detachable from the smoke guiding cup;
the cup body further comprises an opening; the cup body is configured to receive or remove the tobacco material via the opening; and the opening communicates with the first cavity;
a bottom wall is disposed on the other end of the first side wall and is opposite to the opening; and the first side wall and the bottom wall are connected to each other to confine the first cavity; and
the first side wall further comprises a first surrounding portion and a second surrounding portion; the second surrounding portion is connected to the first surrounding portion and the bottom wall; the first flange is disposed on one end of the first surrounding portion away from the second surrounding portion; and the heating element is disposed inside the second surrounding portion.
2. The atomization assembly of claim 1, wherein the atomization cup further comprises a second flange; the first surrounding portion comprises a first surrounding section, a second surrounding section, and a third surrounding section; the second surrounding section is connected to the first surrounding section and the third surrounding section; the first flange protrudes from the outer peripheral surface of the first surrounding section; the third surrounding section is connected to the second surrounding portion; the second flange is disposed on the second surrounding section, and protrudes outward in a circumferential direction of the second surrounding section; an outer diameter of the second flange is smaller than that of the first flange; and the first flange and the second flange form a step.
3. The atomization assembly of claim 1, wherein the through hole is disposed on the bottom wall and/or the first side wall.
4. The atomization assembly of claim 1, wherein the first side wall is in the shape of a cylinder, a three-sided prism, or a square column; and/or the first side wall is integrated with the bottom wall.
5. The atomization assembly of claim 1, wherein the heating element made of the conductive material is configured to generate heat by electrifying or by high frequency magnetic field, and the conductive material is at least one of metal, graphene, semiconductor, superconductor and carbon-containing conductive material; and/or
the first side wall comprises an inner surface and an outer surface; the heating element is disposed on the inner surface and/or the outer surface, or disposed inside the first side wall;
the heating element is in a shape of film, layer, net, or wire, and is disposed on the first side wall in at least one manner selected from embedding, coating, printing, cladding, and pasting; and
the first side wall comprises glass, agate, quartz, crystal, jade, mica, or ceramic.
6. The atomization assembly of claim 1, wherein the bottom wall comprises the heating element made of conductive material, or the bottom wall is made of conductive material; and/or a protective part is disposed on an inner surface and/or an outer surface of the first side wall, and/or disposed on an inner surface and/or an outer surface of the bottom wall.
7. The atomization assembly of claim 6, wherein the protective part comprises glass, agate, quartz, crystal, jade, mica or ceramic; and/or
the conductive material is at least one of metal, graphene, semiconductor, superconductor and carbon-containing conductive material; and/or
the heating element is disposed on the inner surface and/or the outer surface of the bottom wall, or disposed inside the bottom wall;
the heating element is in a shape of film, layer, net, or wire, and is disposed on the bottom wall in at least one manner of embedding, coating, printing, cladding and pasting; and
the bottom wall comprises glass, agate, quartz, crystal, jade, mica, or ceramic.
8. The atomizer assembly of claim 4, wherein the smoke guiding cup comprises a second channel; the atomization cup is detachably disposed in the smoke guiding cup, and the second channel communicates with the through hole.
9. The atomizer assembly of claim 8, wherein the atomization cup is encompassed by the support part; the support part and the connection part are in the shape of a hollow tube; and the support part and the connection part are connected to each other whereby the second channel is formed.
10. The atomizer assembly of claim 9, wherein the connection part comprises a first connecting section and a second connecting section; the first connecting section is connected to the support part and the second connecting section.
11. An atomization assembly, comprising an atomization cup for heating a tobacco material to produce smoke, and a smoke guiding cup for conveying the smoke from the atomization cup to a smoke filter; wherein:
the atomization cup comprises a cup body, the cup body comprises a first side wall, a first cavity confined by the first side wall, and a through hole;
the first cavity is configured to accommodate the tobacco material;
the through hole is configured to convey the smoke generated by the tobacco material out of the atomization cup into the smoke guiding cup;
the through hole communicates with the first cavity;
the first side wall comprises a heating element made of conductive material, or the first side wall is made of conductive material; and
the smoke guiding cup comprises a support part and a connection part, wherein the support part is configured to receive and support the atomization cup, and the support part comprises a second side wall and a second cavity confined by the second side wall; the connection part is connected to the support part, and is configured to be connected to the smoke filter;
the first side wall is disposed in second cavity;
the atomization cup comprises a first flange, the first flange extends circumferentially and radially out from the outer peripheral surface of one end of the first side wall;
the first flange abuts against one end of the second side wall, whereby the atomization cup is supported by and detachable from the smoke guiding cup;
the cup body further comprises an opening; the cup body is configured to receive or remove the tobacco material via the opening; and the opening communicates with the first cavity;
a bottom wall is disposed on the other end of the first side wall and is opposite to the opening; and the first side wall and the bottom wall are connected to each other to confine the first cavity;
the through hole is disposed on the bottom wall; the atomization cup further comprises a guide tube disposed on one side of the bottom wall away from the first cavity; and the guide tube further comprises a first channel connected to the through hole.
12. An atomization assembly, comprising an atomization cup for heating a tobacco material to produce smoke, and a smoke guiding cup for conveying the smoke from the atomization cup to a smoke filter; wherein:
the atomization cup comprises a cup body, the cup body comprises a first side wall, a first cavity confined by the first side wall, and a through hole;
the first cavity is configured to accommodate the tobacco material;
the through hole is configured to convey the smoke generated by the tobacco material out of the atomization cup into the smoke guiding cup;
the through hole communicates with the first cavity;
the first side wall comprises a heating element made of conductive material, or the first side wall is made of conductive material; and
the smoke guiding cup comprises a support part and a connection part, wherein the support part is configured to receive and support the atomization cup, and the support part comprises a second side wall and a second cavity confined by the second side wall; the connection part is connected to the support part, and is configured to be connected to the smoke filter;
the first side wall is disposed in second cavity;
the atomization cup comprises a first flange, the first flange extends circumferentially and radially out from the outer peripheral surface of one end of the first side wall;
the first flange abuts against one end of the second side wall, whereby the atomization cup is supported by and detachable from the smoke guiding cup;
the smoke guiding cup comprises a second channel; the atomization cup is detachably disposed in the smoke guiding cup, and the second channel communicates with the through hole;
the atomization cup is encompassed by the support part; the support part and the connection part are in the shape of a hollow tube; and the support part and the connection part are connected to each other whereby the second channel is formed; and
an inner diameter of the support part is smaller than an outer diameter of the first flange of the atomization cup and not smaller than an outer diameter of a second flange of the atomization cup; the end of the support part away from the first connecting section is connected to a step....

Claims

What is claimed is:
1. An optically pumped on-chip solid-state laser, comprising:
a solid gain media substrate; and
a laser generating structure disposed above the solid gain media substrate; wherein:
the laser generating structure comprises a resonator, a pump light input structure, and a laser light output structure;
the resonator is disposed between the pump light input structure and the laser light output structure, and is propped against or is in clearance fit with the solid gain media substrate; and
the resonator is a dielectric resonator comprising a dielectric material different from a material of the solid gain media substrate, and the dielectric material has a refractive index higher than that of the solid gain media substrate; the resonator has a mode field that overlaps with the solid gain media substrate; pump light is input by the pump light input structure into the resonator from outside, and the pump light in the resonator has a first optical field distribution that overlaps with the solid gain media substrate to form an overlap region, so that the solid gain media substrate is excited in the overlap region to form a population inversion region; and a lasing mode in the resonator has a second optical field distribution that overlaps with the population inversion region in the solid gain media substrate, resulting in gain, and when the gain is greater than loss, laser light is generated and output by the laser light output structure.
2. The laser of claim 1, wherein the resonator is a traveling-wave ring resonator or a whispering gallery resonator.
3. The laser of claim 2, wherein the laser light generated in the resonator is coupled from the resonator to a waveguide through a coupler by evanescent-field coupling.
4. The laser of claim 2, wherein the pump light is coupled from a waveguide into the resonator through a coupler by evanescent-field coupling.
5. The laser of claim 2, wherein the laser light generated in the resonator is coupled from the resonator to a waveguide through a coupler by evanescent-field coupling, and the pump light is coupled from a waveguide into the resonator through the same coupler.
6. The laser of claim 2, wherein the traveling-wave ring resonator is a cross type traveling-wave ring resonator provided with a cross coupler comprising waveguides.
7. The laser of claim 6, wherein the laser light generated in the resonator is output from one of the waveguides of the cross coupler.
8. The laser of claim 6, wherein the pump light is input into the resonator from one of the waveguides of the cross coupler.
9. The laser of claim 6, wherein the pump light is input into the resonator from one of the waveguides of the cross coupler, and the laser light generated in the resonator is output from the same waveguide.
10. The laser of claim 2, wherein the solid gain media substrate comprises a material with a magneto-optical effect, and the magneto-optical effect is generated by an applied magnetic field, so that frequency degeneracy between clockwise and counterclockwise modes of the resonator is lifted, and the laser light is generated only in a single direction, which is clockwise or counterclockwise.
11. The laser of claim 2, wherein a material with a magneto-optical effect is provided near the resonator, and the magneto-optical effect is generated by an applied magnetic field, so that frequency degeneracy between clockwise and counterclockwise modes of the resonator is lifted, and the laser light is generated only in a single direction, which is clockwise or counterclockwise.
12. The laser of claim 11, wherein a permanent magnet, by which the magnetic field is generated, is disposed above the resonator.
13. The laser of claim 12, wherein the mode of the traveling-wave ring resonator is a quasi-transverse magnetic mode, and the permanent magnet, with a diameter difference of 0 to 10% from the traveling-wave ring resonator, is a cylindrical permanent magnet axially magnetized, and disposed above and coaxial with the traveling-wave ring resonator; and the permanent magnet generates a static magnetic field whose principal component at the mode field of the traveling-wave ring resonator is a radial component.
14. The laser of claim 11, wherein the laser light is generated only in a single direction in the resonator, which is clockwise or counterclockwise, thus eliminating spatial hole-burning, and the laser light is in a single longitudinal mode.
15. The laser of claim 11, wherein the laser light generated in the resonator is coupled from the resonator to a waveguide by evanescent-field coupling and output in a single direction.
16. The laser of claim 1, wherein the pump light input structure and the laser light output structure comprise on-chip planar optical waveguides or optical fibers.
17. The laser of claim 2, wherein the resonator is an F—P type standing-wave resonator.
18. The laser of claim 17, wherein reflectors of the F—P type standing-wave resonator are formed by coating end faces of waveguide or by Bragg gratings.
19. The laser of claim 18, wherein the pump light is input through one of the reflectors.
20. The laser of claim 18, wherein the laser light is output through one of the reflectors.
21. The laser of claim 1, wherein the resonator is covered by an upper cover layer with a refractive index lower than that of the dielectric material of the resonator.
22. The laser of claim 1, wherein the solid gain media substrate is a solid laser crystal wafer doped with luminescent ions, and the solid laser crystal wafer is yttrium aluminum garnet (YAG) wafer, sapphire wafer, or lithium niobate wafer....

Claims

What is claimed is:
1. A method, comprising:
playing, by a sound module according to a learning instruction, a vocal content of a word in a second language;
prompting a user to take an object image corresponding to the word through a camera module of a terminal device and upload the object image;
if the object image is uploaded:
receiving, by a processor module, the object image;
identifying the object image according to identification model having standard features for the word, by extracting features from the object image and comparing the extracted features from the object image with the standard features for the word; and judging whether the object image taken by the user is correct;
if the object image taken by the user is correct, feeding back an award to the user by a display module or the sound module; and
if the object image taken by the user is incorrect, feeding backing a correct image of an object corresponding to the word to the user, and/or prompting the user to take an image again; and
if no object image is uploaded during a set period of time, feeding back to the user a vocal content corresponding to the word in a first language.
2. The method of claim 1, further comprising establishing the identification model by means of:
comprising acquiring a plurality of object images corresponding to a plurality of words in different light from various angles;
learning and training by a convolutional neural network algorithm, and establishing the identification model of the plurality of words corresponding to the plurality of object images; and
storing the identification model into the terminal device or a cloud storage module.
3. The method of claim 2, wherein establishing the identification model comprises graying each object image, extracting features of each object image, extracting a standard template by recognition training, and creating a standard feature library.
4. The method of claim 3, wherein the plurality of object images for each word comprise a plurality of standard templates.
5. The method of claim 3, wherein graying each object image comprises processing objects in each object image into a uniform specification by centroid alignment, linear interpolation, and enlargement.
6. The method of claim 1, further comprising replaying the vocal content of the word, and the vocal content of an example sentence comprising the word through the sound module according to a user's request.
7. An electronic device, comprising a memory, processor, and computer program stored in the memory and executed by the processor to conduct the method of claim 1; wherein when the processor executes the computer program, the method is implemented.
8. A computer-readable storage medium comprising a computer program for conducting the method of claim 1; when executed by a processor, the computer program performs the method....

Claims

The invention claimed is:
1. A drug-loaded nanofiber membrane comprising a first fiber and a second fiber; the first fiber comprises poly(lactic-co-glycolic acid) copolymer (PLGA copolymer) and a drug dispersed within the first fiber, and the second fiber comprises poly(p-dioxanone) (PDO);
wherein:
the PLGA copolymer is a mixture consisting of a high-molecular weight PLGA copolymer and a low-molecular weight PLGA copolymer; the high-molecular weight refers to a viscosity-average molecular weight of 100,000 to 150,000 Da, and the low-molecular weight refers to a viscosity-average molecular weight of 40,000 to 80,000 Da;
a mass ratio of the high-molecular weight PLGA copolymer to the low-molecular weight PLGA copolymer is between 25:75 and 3:97; and
a total mass of the second fiber accounts for 1%-25% of a total mass of the first fiber.
2. The membrane of claim 1, wherein the total mass of the second fiber accounts for 1%-15% of a total mass of the first fiber.
3. The membrane of claim 1, wherein a molar ratio of lactic acid unit to hydroxyacetic acid unit in the PLGA copolymer is between 1:1 and 9:1.
4. The membrane of claim 1, wherein a molecular weight of PDO is 60000-250,000 Da.
5. The membrane of claim 1, wherein the drug comprises an antibiotic drug, an anti-tumor drug, an anti-inflammatory drug, or a combination thereof.
6. The membrane of claim 5, wherein the drug comprises ciprofloxacin, ciprofloxacin hydrochloride, moxifloxacin, levofloxacin, cefradine, tinidazole, 5-fluorouracil, adriamycin, cisplatin, paclitaxel, gemcitabine, capecitabine, aspirin, indomethacin, or a combination thereof.
7. The membrane of claim 1, wherein a total mass of the drug accounts for 1%-35% of a total mass of the first fiber and the second fiber.
8. A drug-loaded nanofiber membrane comprising a first fiber, a second fiber, and a drug dispersed into the first fiber; the first fiber comprising poly(lactic-co-glycolic acid) copolymer (PLGA copolymer), and the second fiber comprising poly(p-dioxanone) (PDO);
wherein:
the PLGA copolymer is a mixture of a high-molecular weight PLGA copolymer and a low-molecular weight PLGA copolymer; the high-molecular weight refers to a viscosity-average molecular weight of 100,000 to 150,000 Da, and the low-molecular weight refers to a viscosity-average molecular weight of 60,000 to 80,000 Da;
a mass ratio of the high-molecular weight PLGA copolymer to the low-molecular weight PLGA copolymer is between 25:75 and 3:97; and
a total mass of the second fiber accounts for 1%-25% of a total mass of the first fiber.
9. The membrane of claim 8, wherein the low-molecular weight refers to a viscosity-average molecular weight of 70,000 to 80,000 Da....

Claims

What is claimed is:
1. A clearomizer, comprising a first main body and a second main body; wherein:
the first main body comprises a first distal end away from the second main body; the first distal end comprises a mouthpiece;
the second main body comprises a second distal end away from the first main body; the clearomizer further comprises a first conductive connector and a second conductive connector both disposed on the second distal end;
the first conductive connector and the second conductive connector each are a singular conductive metal attractable by a magnet; and/or
the first conductive connector comprises a first electrode and a first magnetic attraction member; the first magnetic attraction member is hollow and is disposed around an outer periphery of the first electrode; or the first electrode is hollow and is disposed around an outer periphery of the first magnetic attraction member; or the first magnetic attraction member and the first electrode are connected in parallel; the second conductive connector comprises a second electrode and a second magnetic attraction member; the second magnetic attraction member is hollow and is disposed around an outer periphery of the second electrode; or the second electrode is hollow and is disposed around an outer periphery of the second magnetic attraction member; or the second magnetic attraction member and the second electrode are connected in parallel.
2. The clearomizer of claim 1, wherein:
the second distal end comprises at least one recess and an air conduction hole disposed in the at least one recess; the at least one recess communicates with the air conduction hole and extends from side to side through the second distal end; and/or
the second main body has a reduced diameter with respect to the first main body; the first main body comprises a first proximal end disposed near the second main body and a convex edge protruding from the first proximal end.
3. The clearomizer of claim 2, wherein the first main body comprises a chamfer disposed to an edge of the first distal end; the at least one recess extends to the chamfer.
4. The clearomizer of claim 1, wherein:
the air conduction hole is disposed outside a central area of the second distal end; and/or
the first conductive connector and the second conductive connector are symmetrically disposed relative to a straight center line of the second distal end.
5. The clearomizer of claim 1, wherein a cross-section of the second main body is centrosymmetric around a central point.
6. The clearomizer of claim 1, wherein a cross-section of the second main body has a length of 15-21 mm; and/or a cross-section of the second main body has a width of 7-12 mm; and/or the second main body has a height of 15-27 mm.
7. The clearomizer of claim 5, wherein the cross-section of the second main body comprises an outline having four curves that are connected to one another; each two of the four curves are symmetrical with one another with respect to a central line or the central point of the cross-section of the second main body; and each curve comprises a first arc, a second arc, a third arc, and a fourth arc that are connected sequentially to one another.
8. The clearomizer of claim 7, wherein the first arc is an arc of a circle with a radius of 3.3-4.2 mm and has a central angle of 13.5°-16.5°; the second arc is an arc of a circle with a radius of 5-6 mm and has a central angle of 12.7°-15.7°; the third arc is an arc of a circle with a radius of 14.5-15.5 mm and has a central angle of 18°-21.5°; the fourth arc is an arc of a circle with a radius of 18.1-19.1 mm and has a central angle of 39.5°-42°.
9. The clearomizer of claim 6, wherein the cross-section of the second main body has a length of 18-18.6 mm; and/or the cross-section of the second main body has a width of 9-9.9 mm; and/or the second main body has a height of 19-23.5 mm.
10. The clearomizer of claim 5, wherein the cross-section of the second main body comprises an outline having two second arcs and two third arcs, and the two second arcs and the two third arcs are alternately connected in sequence and are centrosymmetric around a central point.
11. The clearomizer of claim 10, wherein
each of the two second arcs is an arc of a circle with a radius of 17.5-19.5 mm and has a central angle of 146°-153°; and each of the two third arcs is an arc of a circle with a radius of 12-14 mm and has a central angle of 27°-34°; and/or
the cross-section of the second main body has a length of 18-18.8 mm and a width of 9.5-10.5 mm; and/or
the outline of the cross-section of the second main body further comprises a fourth arc disposed between each second arc and one third arc; the fourth arc is an arc of a circle with a radius of 0.2-0.6 mm and has a central angle of 1°-3°.
12. The clearomizer of claim 1, wherein the first conductive connector and the second conductive connector each are a singular conductive metal attractable by a magnet; and a distance between centers of the first conductive connector and the second conductive connector is within a range of 9-11 mm; and/or the first conductive connector and the second conductive connector both have a diameter of 4-7 mm.
13. A cartridge, comprising a clearomizer, a column tube for accommodating the clearomizer, a third conductive connector, and a fourth conductive connector; wherein:
the clearomizer comprises a first main body and a second main body; wherein, the first main body comprises a first distal end away from the second main body; the first distal end comprises a mouthpiece; the second main body comprises a second distal end away from the first main body; the clearomizer further comprises a first conductive connector and a second conductive connector both disposed on the second distal end;
the column tube comprises an open top, a cavity, and a bottom wall; the second main body is inserted through the open top into the cavity; the third conductive connector and the fourth conductive connector are disposed on the bottom wall and are electrically connected to the first conductive connector and the second conductive connector, respectively;
the third conductive connector and the fourth conductive connector each are a singular conductive metal attractable by a magnet; and/or
the third conductive connector comprises a third electrode and a third magnetic attraction member; the third magnetic attraction member is hollow and is disposed around an outer periphery of the third electrode; or the third electrode is hollow and is disposed around an outer periphery of the third magnetic attraction member; or the third magnetic attraction member and the third electrode are connected in parallel; the fourth conductive connector comprises a fourth electrode and a fourth magnetic attraction member; the fourth magnetic attraction member is hollow and is disposed around an outer periphery of the fourth electrode; or the fourth electrode is hollow and is disposed around an outer periphery of the fourth magnetic attraction member; or the fourth magnetic attraction member and the fourth electrode are connected in parallel.
14. The cartridge of claim 13, wherein:
the cartridge further comprises an air conduction column and the bottom wall of the column tube comprises a concave portion; the air conduction column is disposed in the concave portion; the first conductive connector and the second conductive connector are disposed outside the concave portion; and/or
the cartridge further comprises a battery, a circuit element, a bracket, and a housing communicating with the column tube; the bracket is disposed in the housing; the battery and the circuit element are disposed in the bracket; the bracket comprises a top portion functioning as the bottom wall of the column tube; the column tube comprises at least one air inlet facing the bottom wall.
15. The cartridge of claim 13, wherein
the cavity is matched with the second main body in shape; and/or
a gap distance between the column tube and the second main body is within a range of 0.1-1 mm; and/or
a height of the second main body is smaller or equal to a depth of the cavity.
16. An electronic cigarette, comprising the clearomizer of claim 1 and a cartridge; wherein the cartridge comprises a column tube for accommodating the clearomizer, a third conductive connector, and a fourth conductive connector; the column tube comprises an open top, a cavity, and a bottom wall; the second main body is inserted through the open top into the cavity; the third conductive connector and the fourth conductive connector are disposed on the bottom wall and are electrically connected to the first conductive connector and the second conductive connector, respectively; the second main body is disposed into the cavity, and the first main body is exposed outside the column tube....

Claims

CLAIM
1. The ornamental design for a storage drawer shelf as shown and described....

Claims

The invention claimed is:
1. An atomizer, comprising a main body; wherein:
the main body comprises an e-liquid chamber, a heating chamber, a heating element, and an e-liquid channel;
the heating element is disposed in the heating chamber;
the main body further comprises at least one e-liquid inlet and at least one e-liquid outlet communicating with two ends of the e-liquid channel, respectively;
the at least one e-liquid inlet is disposed in a bottom part of the e-liquid chamber;
the at least one e-liquid outlet is connected to the heating chamber;
the main body further comprises a mouthpiece connected to and communicating with the heating chamber; when a user inhales smoke or vapor through the mouthpiece, e-liquid is sucked from the e-liquid chamber into the e-liquid channel by a suction force, flows into the heating chamber; and
the at least one e-liquid inlet comprises a distal end and a proximal end; the distal end is away from the e-liquid outlet with respect to the proximal end, and the proximal end is adjacent to the e-liquid outlet with respect to the distal end; an e-liquid conduction channel is formed on the distal end and communicates with the e-liquid channel; and the proximal end is connected to the e-liquid chamber.
2. The atomizer of claim 1, wherein the heating chamber is disposed above the e-liquid chamber and the e-liquid channel; the main body further comprises an e-liquid absorbent member disposed in the heating chamber and connected to the e-liquid outlet.
3. The atomizer of claim 1, wherein the e-liquid channel is annular.
4. The atomizer of claim 3, wherein the main body further comprises an e-liquid conduction member disposed in the e-liquid chamber; the e-liquid conduction member comprises a hollow channel, a first flange, and a second flange; the first flange and the second flange are respectively disposed on both ends of the hollow channel; the first flange comprises a concave part; the at least one e-liquid inlet is disposed on the first flange to communicate with the hollow channel; the second flange comprises an edge and a plurality of notches disposed on the edge; each of the plurality of notches communicates with the e-liquid chamber.
5. The atomizer of claim 4, wherein the concave part has a depth of 0.2-0.6 mm.
6. The atomizer of claim 4, wherein the main body further comprises a fixing member; the fixing member comprises a first concave portion and a first hollow column; the first concave portion comprises a bottom surface and the first hollow column is disposed in the middle of the bottom surface; and the first flange abuts against the bottom surface so that the first hollow column is disposed into the hollow channel; and the e-liquid conduction channel is formed between the concave part and the bottom surface of the fixing member.
7. The atomizer of claim 5, wherein
the main body further comprises an e-liquid injection member; the e-liquid injection member comprises a bottom end and the bottom end is concave to form a second concave portion; the second concave portion comprises a top wall; the top wall comprises a second hollow column and the e-liquid outlet is disposed on the top wall; the second flange abuts against the top wall of the second concave portion so that the second hollow column is disposed through the hollow channel and connected to the first hollow column; an upper side of the e-liquid outlet is connected to the heating element; and a lower side of the e-liquid outlet is connected to the e-liquid channel; and
an annular channel is defined by an inner wall of the e-liquid conduction member, an outer wall of the first hollow column, and an outer wall of the second hollow column; and the annular channel functions as the e-liquid channel.
8. The atomizer of claim 7, wherein the main body further comprises an e-liquid storage member comprising an e-liquid passage; one end of the e-liquid storage member abuts against the fixing member and the other end of the e-liquid storage member abuts against the bottom end of the e-liquid injection member; the e-liquid chamber is defined by the first concave portion, the e-liquid passage, and the second concave portion; and the e-liquid chamber is around the e-liquid conduction member.
9. The atomizer of claim 8, wherein the e-liquid injection member comprises an outer wall comprising at least one first through hole; the at least one first through hole communicates with the e-liquid chamber; and the at least one first through hole has a diameter of 3-6 mm.
10. The atomizer of claim 9, wherein
the liquid injection member further comprises a top end and a first electrode disposed on the top end; the first electrode is formed integrally with the liquid injection member; the main body further comprises an insulating member and a conductive part disposed in the insulating member; the insulating member is configured to isolate the conductive part and the e-liquid injection member; the conductive part further comprises a top portion and a second electrode disposed on the top portion; the second electrode is formed integrally with the conductive part; the first electrode and the second electrode are electrically connected to both ends of the heating element, respectively; and
the conductive part further comprises a bottom portion comprising a third hollow column; the third hollow column extends from the middle of the bottom portion into the second hollow column; and the heating element is disposed on the e-liquid absorbent member.
11. The atomizer of claim 10, wherein
the main body further comprises an atomizing member comprising the heating chamber; the top end of the e-liquid injection member is disposed in a bottom of the atomizing member so that the heating element is disposed in the heating chamber; and
the atomizing member further comprises a side wall comprising at least one second through hole; the at least one second through hole communicates with the heating chamber; the heating element and the e-liquid absorbent member occupies three-fifths to four-fifths of the volume of the heating chamber.
12. The atomizer of claim 11, wherein the main body further comprises an airflow regulator disposed on the atomizing member; the airflow regulator comprises a side wall comprising at least one air inlet; the at least one air inlet is opposite to the at least one second through hole and the heating element; the airflow regulator is configured to rotate around the outer wall of the atomizing member so as to regulate the amount of air flowing out of the atomizer; the mouthpiece is disposed on a top end of the atomizing member and comprises a cavity communicating with the heating chamber; and an outer diameter of the at least one air inlet is larger than an inner diameter thereof.
13. An electronic cigarette, comprising the atomizer of claim 1 and a battery assembly....

Claims

What is claimed is:
1. A hookah, comprising a glass tube, a push rod having an air passage, and an assistant push rod; the glass tube, the push rod, and the assistant push rod being arranged such that the assistant push rod sleeves only a first half of the push rod which is movably disposed inside the glass tube and configured to move along an inner wall thereof upon an action of the assistant push rod, and a space is formed between a bottom opening of the glass tube and a bottom end of the push rod; wherein,
when in use, tobacco material is loaded both in the glass tube and in the space, and wherein smoke produced by atomization of the tobacco material flows in the air passage of the push rod.
2. The hookah of claim 1, further comprising a silicone ring, wherein the silicone ring is disposed in a top opening of the assistant push rod and between the assistant push rod and the push rod, so that owing to a frictional force, a movement of the assistant push rod drives the push rod to move.
3. The hookah of claim 2, further comprising a slidable cylinder, a push button, and a screw, wherein the assistant push rod is disposed in the slidable cylinder; a bottom opening of the slidable cylinder is located in a top opening of the glass tube; the push button extends from a guide groove of the slidable cylinder to abut against a top end of the assistant push rod and is fixed by the screw; the push button moves in the guide groove of the slidable cylinder to control the movement of the assistant push rod.
4. The hookah of claim 3, further comprising a location pin, wherein the location pin is disposed on the assistant push rod; a plurality of continuous grooves is disposed on an inner wall of the slidable cylinder and matches the location pin for controlling a forward distance of the assistant push rod to ensure an output amount of the tobacco material for each push.
5. The hookah of claim 3, further comprising an outer air tube, a water-storage glass tube, an inner air tube, and a fixed base, wherein the fixed base is disposed in a top opening of the slidable cylinder; a top end of the push rod is sheathed with a second seal ring disposed in the fixed base; the inner air tube is disposed through the fixed base and communicates with the push rod; the outer air tube sleeves the inner air tube and is fixed on the fixed base; a lower seal ring sleeves the fixed base to seal a bottom opening of the water-storage glass tube; the water-storage glass tube is supported by the fixed base and the outer air tube is disposed in the water-storage glass tube.
6. The hookah of claim 5, further comprising an inversion valve disposed on a top of the inner air tube and between the inner air tube and the outer air tube to block water in the water-storage glass tube and prevent the water in the water-storage glass tube from entering the inner air tube.
7. The hookah of claim 6, wherein an outer wall of the outer air tube comprises at least one through hole for smoke discharge.
8. The hookah of claim 7, further comprising a mouthpiece, a check valve, and a mouthpiece holder, wherein a lower part of the mouthpiece holder comprises a vent hole, and an upper part of the mouthpiece holder is disposed in a top opening of the water-storage glass tube; the lower part of the mouthpiece holder is fixed in a top opening of the outer air tube; the check valve is disposed in the mouthpiece to block reverse air, thus preventing air reversing from the mouthpiece from entering the water storage glass tube; and the mouthpiece is disposed on the mouthpiece holder.
9. The hookah of claim 8, further comprising a metal tube, wherein after use, the metal tube sleeves the glass tube and the slidable cylinder, and a top end of the metal tube is fixed on the fixed base to protect the glass tube and quench the tobacco material.
10. The hookah of claim 1, wherein the push rod comprises a hollow structure comprising the air passage and the bottom end of the push rod comprises a plurality of evenly distributed through holes....

Claims

What is claimed is:
1. A computer-implemented automatic precision calculation method of an imaging pose of a rotational linear array scanning image, the method comprising:
at step S101, using a linear array camera provided on a rotational cradle head to collect one group of rotational linear array scanning images and recording a collection parameter of the rotational linear array scanning image and a camera intrinsic parameter;
at step S102, according to the camera intrinsic parameter and the image collection parameter of the step S101, projecting the rotational linear array scanning image to a tangent plane of the rotational linear array scanning image by orthographic projection transformation to generate an equivalent frame image having the approximately same intrinsic and extrinsic parameters as the rotational linear array scanning image and calculate a coordinate of each pixel of the equivalent frame image projected onto the rotational linear array scanning image based on an inverse projection transformation calculation method;
at step S102, the tangent plane being tangent to an image plane of the rotational linear array scanning image at a central scanning line, and projecting the rotational linear array scanning image to the tangent plane of the image in the following implementation:
for a particular point pr on the rotational scanning imaging plane, a coordinate of image is (xr, yr), a rotation angle of the central scanning line with respect to the central scanning line is ω, an included angle between an incident ray of the point and a principal optical axis of the central scanning line where the point is located is γ, and both are calculated as follows:
ω
=
(
x
r
-
p
x
r
)
⁢
α
x
;
γ
=
arc
⁢
tan
⁢
y
r
-
p
y
r
f
;
wherein pxr is an abscissa of the central scanning line, and pyr is an ordinate of an image principal point of the rotational linear array scanning image;
based on projection relationship, a coordinate of an intersection point pf of the incident line of the point pr and the equivalent frame imaging plane under an equivalent frame image coordinate system is calculated in the following formula:
{
x
f
=
sin
⁢
ω
tan
⁢
(
ϕ
c
+
γ
)
⁢
sin
⁢
ϕ
c
+
cos
⁢
ω
⁢
cos
⁢
ϕ
c
·
1
tan
⁢
α
x
+
p
x
f
y
f
=
tan
⁢
(
ϕ
c
+
γ
)
⁢
cos
⁢
ϕ
c
-
cos
⁢
ω
⁢
sin
⁢
ϕ
c
tan
⁢
(
ϕ
c
+
γ
)
⁢
sin
⁢
ϕ
c
+
cos
⁢
ω
⁢
cos
⁢
ϕ
c
·
1
tan
⁢
α
x
+
p
y
f
;
wherein (xf, yf) is a coordinate of the equivalent frame image, ϕc is a camera set pitch angle, αx is an included angle of adjacent scanning lines, (pxf, pyf) is a coordinate of an image principal point of the rotational linear array scanning image, and f is a lens focal length;
at step S103, by using structure-from-motion method, automatically calculating a pose parameter of the equivalent frame image and a corresponding waypoint three-dimensional coordinate; and
at step S104, with the pose parameter of the equivalent frame image as an initial value, obtaining an accurate imaging parameter of the rotational linear array scanning image by an optimal estimation method.
2. The method of claim 1, wherein,
the collection parameter of the rotational linear array scanning image of step S101 comprises: the camera set pitch angle, the included angle of adjacent scanning lines, or an included angle of adjacent scanning lines obtained by calculation based on equivalent camera rotational velocity and an exposure time, and a lens distortion parameter;
the included angle parameter αx of adjacent scanning lines is obtained based on the exposure time t of the rotational cradle head velocity ω: αx=ωt; to ensure the scanning linear array image is not subjected to compression, or stretched deformation, the included angle of adjacent scanning lines is set to be same as an instantaneous field of view angle of the linear array camera, the included angle is a requisite parameter for imaging of the rotational scanning linear array camera and obtained from meta data of an imaging set record or image file; and
the camera set pitch angle refers to a dihedral angle between a plane where the principal optical axis of the linear array camera is located and a plane perpendicular to a rotational shaft of the linear array camera, which is also equivalent to an included angle of the scanning line and the rotational shaft.
3. The method of claim 1, wherein, the camera intrinsic parameter in step S101 comprises a lens focal length, a coordinate of an image principal point and lens radial and tangential distortion parameters;
the lens focal length is expressed with pixel as unit, and directly calculated based on the lens focal length and a size of an imaging unit, or obtained by camera calibration method;
the coordinate of the image principal point is an image coordinate of an intersection point of the principal optical axis of the camera and the imaging plane of linear array camera; since the linear array camera has only one scanning line, the abscissa is 0 constantly, and the ordinate is obtained by camera calibration or by using a coordinate of the central pixel as an approximate value; and
the lens distortion parameter uses a Brown model and comprises a radial distortion and a tangential distortion, both of which only consider second-order parameter case, and for a camera without calibration parameter, 0 is used as an initial value of the lens distortion parameter.
4. The method of claim 1, wherein, the camera set pitch angle (I), is obtained in the following manner:
(a) selecting a projection curve of one straight line in a scenario on the rotational linear array scanning image, where the projection curve is not parallel to any scanning lines;
(b) selecting three points on the projection curve, wherein an included angle of line segments between the three points is less than 180° and the line segments are not on one straight line;
(c) according to an equivalent frame projection formula,
{
x
f
=
sin
⁢
ω
tan
⁢
(
ϕ
c
+
γ
)
⁢
sin
⁢
ϕ
c
+
cos
⁢
ω
⁢
cos
⁢
ϕ
c
·
1
tan
⁢
α
x
+
p
x
f
y
f
=
tan
⁢
(
ϕ
c
+
γ
)
⁢
cos
⁢
ϕ
c
-
cos
⁢
ω
⁢
sin
⁢
ϕ
c
tan
⁢
(
ϕ
c
+
γ
)
⁢
sin
⁢
ϕ
c
+
cos
⁢
ω
⁢
cos
⁢
ϕ
c
·
1
tan
⁢
α
x
+
p
y
f
,
projecting the above three points onto the equivalent frame image; and
(d) according to a constraint that the three projection points on the equivalent frame image are on a same straight line, solving the camera set pitch angle.
5. The method of claim 1, wherein, a general flow of the inverse projection transformation calculation method in step S102 is as follows:
(1) projecting four corner points of the rotational linear array scanning image and the image principal point of the central scanning line to the equivalent frame image;
(2) according to a coordinate scope of the four corner points after projection, i.e. abscissas of leftmost and rightmost pixels and ordinates of lowermost and uppermost pixels, determining a length and a width of the equivalent frame image wherein a projection coordinate of the image principal point of the central scanning line is the coordinate of the image principal point of the equivalent frame image;
(3) calculating a coordinate of each pixel of the equivalent frame image inversely projected onto the rotational linear array scanning image; and
(4) according to the rotational scanning linear array coordinate, resampling an image brightness value to obtain a pixel brightness value of the equivalent frame image.
6. The method of claim 5, wherein, in step S102, the coordinate of each pixel of the equivalent frame image inversely projected to the rotational linear array scanning image is calculated based on inverse projection transformation calculation method in the following implementation:
for a rotational linear array scanning image having a total of m scanning lines, the coordinate of the central scanning line is m/2, the central scanning line is denoted as AB, and the principal optical axis corresponding to the central scanning line is OC and thus there is a relationship AB⊥OC;
1) calculating a vector expression v1 of a line Opf connecting the point pf on the tangent plane and a corresponding projection center O;
specifically, firstly calculating the expressions of the line segments OC and Cpf respectively;
{right arrow over (OC)}=[0,f sin ϕc,f cos ϕc]
{right arrow over (Cpf)}=f tan αx[(xf−pxf),(yf−pyf)cos ϕc,−(yf−pyf)sin ϕc]
in the above formulas, calculating v1={right arrow over (OC)}+{right arrow over (Cpf)};
2) based on the above vector, calculating a rotational angle ω of the scanning line where the point pf is located with respect to the central scanning line and further calculating a scanning line coordinate xr;
specifically, calculating {right arrow over (Opf)}={right arrow over (OC)}+{right arrow over (Cpf)}, to obtain a rotation angle ω of the plane where the {right arrow over (Opf)} is located with respect to a visual plane of the central scanning line;
ω
=
arc
⁢
tan
⁢
(
x
⁡
(
Op
f
⟶
)
z
⁡
(
Op
f
⟶
)
)
=
arc
⁢
tan
⁢
(
(
x
f
-
p
x
f
)
⁢
tan
⁢
α
x
cos
⁢
ϕ
c
-
(
y
f
-
p
y
f
)
⁢
tan
⁢
α
x
⁢
sin
⁢
ϕ
c
)
and then, according to the included angle of adjacent scanning lines and the central scanning line coordinate, calculating a coordinate of an inverse projection point x on the rotational scanning image:
xr=ω/αx+pxr
3) calculating a vector expression v2 of the principal optical axis of the scanning line where the point pf is located;
the vector of the principal optical axis of the scanning line where the point pf is located, i.e. of the line segment OC rotating by an angle of co around the rotation axis is expressed as:
v2=[f cos ϕc sin ω,f sin ϕc,f cos ϕc cos ω]
4) calculating the included angle of v1 and v2, i.e. the included angle γ of the image point and the principal optical axis, and further calculating the ordinate yr of the scanning line;
specifically, according to the above expressions of v1 and v2, in combination with vector dot product calculation formula, obtaining the included angle γ of the pf and the principal optical axis of the scanning line where the point pf is located:
γ
=
arc
⁢
cos
⁢
(
v
⁢
1
·
v
⁢
2
❘
"\[LeftBracketingBar]"
v
⁢
1
❘
"\[RightBracketingBar]"
⁢
❘
"\[LeftBracketingBar]"
v
⁢
2
❘
"\[RightBracketingBar]"
)
;
finally, according to the lens focal length and the coordinate of the image principal point, calculating the final coordinate of the inverse projection point y:
yr=f tan γ+pyr.
7. The method of claim 1, wherein, the step S103 is implemented as follows:
for a rotational linear array scanning image, firstly using an automatic detection and matching method of feature point or manual point selection method to determine a homonymy point correspondence between images and then projecting coordinates of homonymy points of all images to the corresponding equivalent frame image, and finally using an existing structure-from-motion method, incremental SFM or global SFM method, or automatic three-dimensional reconstruction software, taking the focal length and the coordinate of the image principal point of the equivalent frame image as known parameters, and in a case of a condition of not performing optimization, restoring the pose parameter of the equivalent frame image and the waypoint three-dimensional coordinate corresponding to the homonymy point, wherein the pose parameter comprises a three-dimensional coordinate and an imaging pose of an image projection center.
8. The method of claim 1, wherein, the step S104 is implemented as follows:
with any rectangular coordinate system as a world coordinate system, its coordinate value is (Xw, Yw, Zw); with a rotational shaft of the rotational cradle head as y axis and the principal optical axis corresponding to the first scanning line as z axis, constructing a right-hand rectangular coordinate system as a sensor coordinate system, wherein its coordinate value is denoted as (Xs, Ys, Zs); with the principal optical axis of a moment as z axis and the rotational shaft as y axis, constructing a right-hand rectangular coordinate system XtYtZt as a rotational cradle head coordinate system; with the principal point of the linear array camera as origin, the principal optical axis as z axis and y axis parallel to the scanning line, constructing a right-hand rectangular coordinate system XcYcZc as a camera coordinate system; with an upper left point of an imaging two-dimensional plane as origin and the scanning line as y axis, constructing a two-dimensional plane coordinate system uv as an image coordinate system, describing the transformation from the world coordinate system to the image coordinate system based on the following formula, i.e. a rigorous imaging model of the rotational scanning linear array camera:
[
f
x
0
p
x
r
0
f
y
p
y
r
0
0
1
]
⁢
R
T
→
C
(
R
S
→
T
⁢
R
W
→
S
[
X
w
-
X
0
Y
w
-
Y
0
Z
w
-
Z
0
]
+
[
e
x
e
y
e
z
]
)
=
s
[
0
v
1
]
wherein RT→C is a camera set matrix describing a camera set pose; [ex, ey, ez]T is an offset vector of the camera coordinate system describing eccentricity of a camera setting; for convenience of descriptions, the origin of the rotational cradle head coordinate system is defined as projection of the origin of the camera coordinate system on the y axis of the rotational cradle head coordinate system, and thus ey=0; RS→T is a rotational cradle head rotation matrix describing a rotational angle of the rotational cradle head, which is generated by calculation using a single angle parameter; RW→S and [X0, Y0, Z0]T are a rotation matrix and a translation vector from the world coordinate system to the sensor coordinate system; s is a scale parameter; v is an ordinate of an image of the projection point; fy is a lens focal length value along the direction of y axis, fx is a lens focal length value along the direction of x axis, (pxr, pyr) is a coordinate of an image principal point of the camera; for a rotational scanning linear array camera, the abscissa of the projection point is 0 constantly, and thus pxr=0, and the value fx does not affect the final position of the projection point, and therefore it is not a imaging model parameter;
RT→C is obtained by multiplying the rotation matrix corresponding to a pitch angle ϕc, a yaw angle ωc and a roll angle κc of the camera in the following formula:
R
T
→
C
=
[
a
11
a
12
a
13
a
21
a
22
a
23
a
31
a
32
a
33
]
=
[
1
0
0
0
cos
⁢
ϕ
c
-
sin
⁢
ϕ
c
0
sin
⁢
ϕ
c
cos
⁢
ϕ
c
]
[
cos
⁢
ω
c
0
sin
⁢
ω
c
0
1
0
-
sin
⁢
ω
c
0
cos
⁢
ω
c
]
[
cos
⁢
κ
c
-
sin
⁢
κ
c
0
sin
⁢
κ
c
cos
⁢
κ
c
0
0
0
1
]
wherein α11, . . . , α33 are parameters of the rotation matrices;
RS→T is the rotational cradle head rotation matrix; since the rotational scanning imaging cradle head rotates around the y axis, the matrix is generated using a single angle parameter θ in the following calculation formula:
R
S
→
T
=
[
cos
⁢
θ
0
sin
⁢
θ
0
1
0
-
s
⁢
in
⁢
θ
0
cos
⁢
θ
]
RW→S is a rotation matrix from the world coordinate system to the sensor coordinate system, which is also obtained by using three pose angles (ϕs, ωs, κs) in the following calculation formula:
R
S
→
T
=
[
1
0
0
0
cos
⁢
ϕ
s
-
sin
⁢
ϕ
s
0
sin
⁢
ϕ
s
cos
⁢
ϕ
s
]
[
cos
⁢
ω
s
0
sin
⁢
ω
s
0
1
0
-
sin
⁢
ω
s
0
cos
⁢
ω
s
]
[
cos
⁢
κ
s
-
sin
⁢
κ
s
0
sin
⁢
κ
s
cos
⁢
κ
s
0
0
0
1
]
in a word, the rigorous imaging model of the rotational scanning linear array camera comprises a total of 14 parameters, i.e. the accurate imaging parameters of the rotational linear array scanning image, wherein,
2 camera intrinsic parameters: fy and pyr;
6 rotational cradle head parameters: θ, (ϕc, ωc, κc), ex, ez;
6 extrinsic parameters of the imaging system: (ϕs, ωs, κs) and [X0, Y0, Z0];
through arrangement, the above rigorous imaging model is expressed as:
[
f
x
0
p
x
r
0
f
y
p
y
r
0
0
1
]
[
a
1
⁢
1
⁢
X
ˆ
+
a
1
⁢
2
⁢
Y
ˆ
+
a
1
⁢
3
⁢
Z
ˆ
a
21
⁢
X
ˆ
+
a
2
⁢
2
⁢
Y
^
+
a
2
⁢
3
⁢
Z
ˆ
a
3
⁢
1
⁢
X
ˆ
+
a
3
⁢
2
⁢
Y
^
+
a
3
⁢
3
⁢
Z
ˆ
]
=
s
[
0
v
1
]
the calculation formula of the [{circumflex over (X)}, Ŷ, {circumflex over (Z)}]T is as follows:
[
X
^
Y
^
Z
^
]
=
[
X
s
⁢
cos
⁢
(
θ
)
-
Z
s
⁢
sin
⁢
(
θ
)
-
e
x
Y
s
X
s
⁢
sin
⁢
(
θ
)
-
Z
s
⁢
cos
⁢
(
θ
)
-
e
z
]
in this case, an analytical expression of the image coordinate of the projection point is solved:
{
y
=
f
y
⁢
a
2
⁢
1
⁢
X
^
+
a
2
⁢
2
⁢
Y
^
+
a
2
⁢
3
⁢
Z
ˆ
a
3
⁢
1
⁢
X
^
+
a
3
⁢
2
⁢
Y
^
+
a
3
⁢
3
⁢
Z
ˆ
+
p
y
r
x
=
1
α
x
⁢
arc
⁢
sin
⁢
(
-
b
⁢
c
±
❘
"\[LeftBracketingBar]"
a
❘
"\[RightBracketingBar]"
⁢
a
2
+
b
2
-
c
2
a
2
+
b
2
)
+
p
x
r
wherein,
{
a
=
a
1
⁢
1
⁢
X
s
+
a
1
⁢
3
⁢
Z
s
b
=
a
1
⁢
3
⁢
X
s
-
a
1
⁢
1
⁢
Z
s
c
=
a
1
⁢
2
⁢
Y
s
-
a
1
⁢
1
⁢
e
x
-
a
1
⁢
3
⁢
e
Z
....

Claims

What is claimed is:
1. A method for troubleshooting hidden dangers of trees near power transmission lines by combining ice, cloud, and land elevation satellite-2 (ICESat-2) with JiLin-1 (JL-1) images, the method comprising:
step 1: acquiring ICESat-2 LiDAR data, JL-1 image data, auxiliary data and three-dimensional information data about the power transmission lines within a target area;
step 2: carrying out image preprocessing on a JL-1 image according to a preprocessing method comprising radiometric correction, geometric correction, scale unification, splicing to generate a first image;
step 3: screening the ICESat-2 LiDAR data according to a screening rule to remove laser-generated tree height data with large error and obtain high-quality laser-generated tree height data;
wherein, screening the ICESat-2 LiDAR data according to the screening rule comprises: firstly, setting a fine screening condition based on a quality control parameter of ICESat-2 LiDAR data as follows:
a number of ICESat-2 LiDAR photons is greater than 140;
a percentage of canopy photons account for more than 5% of total ICESat-2 LiDAR photons;
a night identifier is night;
a city identifier is not city;
a land cover type is tree;
a geographical location accuracy is less than 6.5 m; and
a canopy height error is less than 7 m;
and then, loading the laser tree height data subjected to the screening onto the first image, checking shade and bare soil areas in the first image and culling abnormal points if the laser-generated tree height data falls in the shade and bare soil areas, the data is abnormal and needs to be eliminated, so as to obtain the high-quality laser tree height data;
step 4: by employing the first image, the high-quality laser tree height data and the auxiliary data, training a neural network model for retrieving a forest tree height according to a JL-1 image and the auxiliary data;
step 5: by employing the neural network model, generating a height distribution map of densely-covered trees in the target area; and
step 6: according to the height distribution map of densely-covered trees and the three-dimensional information about the power transmission lines, calculating a height difference between a tree and a power transmission line nearest the tree to generate a hidden danger troubleshooting theme map.
2. The method of claim 1, wherein step 1 is implemented by:
acquiring a latitude and longitude range of the target area;
acquiring a JL-1 image covering the target area and an imaging time;
acquiring the ICESat-2 LiDAR data within the latitude and longitude range of the target area, wherein the acquisition time of the JL-1 image and the imaging time do not exceed specified thresholds;
acquiring the auxiliary data within the latitude and longitude range of the target area, the auxiliary data comprising DEM, slope, aspect, humidity, precipitation and accumulated temperature; and
acquiring the three-dimensional information about the power transmission lines in the latitude and longitude range of the target area, the three-dimensional information comprising the longitudes, latitudes and heights of the power transmission lines.
3. The method of claim 1, wherein step 2 is implemented by:
carrying out radiometric calibration and geometric correction on the JL-1 image;
if there are a plurality of images, carrying out relative radiometric correction on the plurality of JL-1 images; and
carrying out scale standardization and image splicing on the JL-1 image with a standard of an ICESat-2 data scale so as to obtain the first image.
4. The method of claim 3, wherein the radiometric calibration is implemented by: performing radiometric calibration on the JL-1 image in the following formula to generate a radiance image:
L=gain×DN+bias
where, L refers to a radiance; gain and bias respectively refer to a gain and a bias of a JL-1 sensor, which is obtained from a JL-1 image file; and DN refers to an image pixel value; and
the geometric correction is implemented by: collecting a JL-1 image to be corrected and a digital elevation model image capable of covering an entire area of the image to be corrected, where the JL-1 image contains rational polynomial coefficient parameters describing imaging geometry, and a coordinate system of the digital elevation model image is a WGS84 coordinate system; then, according to a rational function imaging model, as shown in the following formula, calculating a corresponding relationship between pixels of an orthophoto image and pixels of the JL-1 image to be corrected; and finally, generating a geometrically-corrected JL-1 orthophoto image through pixel resampling;
X
=
N
⁢
u
⁢
m
1
(
P
,
L
,
H
)
D
⁢
e
⁢
n
1
(
P
,
L
,
H
)
,
Y
=
N
⁢
u
⁢
m
2
(
P
,
L
,
H
)
D
⁢
e
⁢
n
2
(
P
,
L
,
H
)
where,
Num1(P,L,H)=a1+a2L+a3P+a4H+a5LP+a6LH+a7PH+a8L2+a9P2+a10H2+a11PLH+a12L3+a13LP2+a14LH2+a15L2P+a16P3+a17PH2+a18L2H+a19P2H+a20H3,
Den1(P,L,H)=b1+b2L+b3P+b4H+b5LP+b6LH+b7PH+b8L2+b9P2+b10H2+b11PLH+b12L3+b13LP2+b14LH2+b15L2P+b16P3+b17PH2+b18L2H+b19P2H+b20H3,
Num2(P,L,H)=c1+c2L+c3P+c4H+c5LP+c6LH+c7PH+c8L2+c9P2+c10H2+c11PLH+c12L3+c13LP2+c14LH2+c15L2P+c16P3+c17PH2+c18L2H+c19P2H+c20H3,
Den2(P,L,H)=d1+d2L+d3P+d4H+d5LP+d6LH+d7PH+d8L2+d9P2+d10H2+d11PLH+d12L3+d13LP2+d14LH2+d15L2P+d16P3+d17PH2+d18L2H+d19P2H+d20H3,
(X, Y) refers to a coordinate of a regularized image point, (P, L, H) refers to a coordinate of a regularized ground point, ai, bi, ci and di refer to coefficients of rational polynomials, and i is in a range of 1 to 20.
5. The method of claim 3, wherein carrying out relative radiometric correction on the plurality of JL-1 images is implemented by: counting a gray histogram of each waveband of each image; and with one of the images as a reference image, carrying out histogram matching on each waveband of the other images based on a corresponding waveband of the reference image to achieve the relative radiometric correction among the images, thereby eliminating a radiance difference caused by a same sensor due to its own reasons.
6. The method of claim 3, wherein carrying out scale standardization and image splicing on the JL-1 image to obtain a first image is implemented by: calculating an average value of pixels in each 5×5 region of each pixel of the JL-1 image as a DN value of a new pixel, so as to achieve a scale unification between two types of data; and finally, carrying out image splicing to obtain the first image, and calculating a normalized differential vegetation index (NDVI) value, where the DN value is an image pixel value.
7. The method of claim 1, wherein step 4 is implemented by: calculating a ratio vegetation index RVI, an enhanced vegetation index EVI and a soil adjusted vegetation index SAVI on the first image, extracting reflectance parameters of wavebands and auxiliary data comprising elevation, slope, aspect, humidity, accumulated temperature and precipitation, calculating correlations of the vegetation indexes, the reflectance parameters of wavebands, the auxiliary data and the tree height, and selecting retrieval parameters according to the size of the correlations; and randomly dividing tree height samples into 80% and 20%, where 80% is used as training data and 20% is used as verification data; carrying out training, parameter optimization and verification on the neural network model by taking the selected indexes and tree heights as input and output parameters of the neural network model.
8. The method of claim 7, wherein step 5 is implemented by: inputting the vegetation indexes, reflectance parameters of wavebands and auxiliary data of an area on which no laser point is covered in the target area into the neural network model, and outputting tree heights of the area on which no laser point is covered in the target area, so as to generate a height distribution map of densely-covered trees in the target area.
9. The method of claim 1, wherein step 6 is implemented by:
importing the three-dimensional information about the power transmission lines into the height distribution map of densely-covered trees in the target area; establishing a buffer area near the power transmission line; calculating a height difference between a tree in the buffer area and a power transmission line nearest the tree, where the height difference is equal to a height of the tree minus a height of the power transmission line, positive values are denoted in red, negative values of which the absolute values are less than 3 m are denoted in yellow, and negative values of which the absolute values are greater than 3 m are denoted in blue; drawing the hidden danger troubleshooting theme map, and carrying focused inspection for red and yellow areas in the distribution map to realize hidden dangers troubleshooting....

Claims

What is claimed is:
1. A method for quantitative multi-parameter mapping of whole liver in one scan, the method comprising:
(1) modifying an echo-planar-imaging (EPI) sequence according to required quantitative multi-parameter maps of liver tissue to be measured;
wherein multiple parameters comprise transverse relaxation time T2 and effective transverse relaxation time T2;
(2) importing the modified EPI sequence into a magnetic resonance imaging (MRI) scanner; using the MRI scanner to scan the liver in the body within one breath-hold, thus obtaining raw k-space data for each slice of the liver scanned at each echo time;
(3) processing the raw k-space data by a parallel imaging method to obtain images acquired at each echo time;
(4) extracting image pairs with opposite phases encoding directions to estimate an inhomogeneous main magnetic field B0 map that causes images distortions; incorporating the B0 map into an encoding matrix with a low rank constraint to form a joint reconstruction model; and solving the joint reconstruction model to obtain reconstructed images of multiple slices of the liver scanned at each echo time;
(5) determining a dynamic range and step size of the quantitative parameters; and using a Bloch equation to form a dictionary that stores information about echo signals over time; and
(6) matching each pixel point in the reconstructed images pixelwise in 4) with a corresponding echo signal stored in the dictionary, so as to identify each pixel by specific values of the quantitative parameters, thus obtaining a quantitative multi-parameter map.
2. The method of claim 1, wherein in 1), the EPI sequence comprises a series of events: two excitation pulses P1 and P2 of different flip angles in an interleaved manner; repetition time (TR) is a term for a timespan between successive excitation pulses P1; a gradient-echo, a spin-echo, and a mixed-spin-and-gradient-echo are generated during each TR; the excitation pulse P2 is applied between the gradient-echo and mixed-spin-and-gradient-echo; and the echoes of adjacent repetition times have opposite phase encoding directions.
3. The method of claim 1, wherein in 1), the EPI sequence is jointly acquired by msBUDA and SAGE; where, msBUDA is a multi-shot EPI method that acquires two successive shots of data with opposite phase encoding directions, so that the images pairs with geometric distortions that are equal but in opposite directions are obtained and used to estimate the inhomogeneous main magnetic field B0 map that causes image distortions; SAGE is a data acquisition method in which additional EPI readouts for spin-echo, gradient-echo, and mixed-spin-and-gradient-echo are added into the EPI sequence in each TR.
4. The method of claim 1, wherein the image pairs corresponding to the two adjacent echoes of the same type are processed by topup in FSL to estimate the inhomogeneous main magnetic field B0 map.
5. The method of claim 1, wherein the joint reconstruction model is described as follows:
min
x
∑
s
=
1
N
s

F
s
⁢
W
s
⁢
C
⁢
x
s
-
d
s

2
2
+
λ
⁢

H
⁡
(
x
)

*
where, Fs is an undersampled Fourier operator in the sth shot; Ws is a distortion operator based on the inhomogeneous main magnetic field B0 map estimated by topup in FSL in the sth shot; Ns is a total number of shots; C is the coil sensitivity map estimated from the distortion-free GRE data; xs is the reconstructed images in the sth shot; ds is the k-space data of the sth shot; ∥ ∥2 means Euclidean norm; ∥ ∥* means nuclear norm; λ is a weighting coefficient; x is a set of all xs; ∥H(x)∥* and enforces low-rank prior on the block-Hankel representation of the blip-up and blip-down data.
6. The method of claim 1, wherein in 4), the joint reconstruction model is solved using iterative projection onto convex sets (POCS) to obtain the reconstructed images of multiple cross-sections of the liver scanned at each echo time; iteration is alternated between data consistency and low-rank truncation, and ceases when the tolerance of root mean square error (RSME) between two successive iterations is less than 0.01%.
7. The method of claim 1, wherein the Bloch equation is as follows:
S
⁡
(
t
)
=
{
S
0
I
⁢
e
-
t
·
R
2
*
,
0
<
t
<
T
/
2
S
0
I
⁢
I
⁢
e
-
T
·
(
R
2
*
-
R
2
)
⁢
e
-
t
·
(
2
⁢
R
2
-
R
2
*
)
,
T
/
2
<
t
<
T
where, S(t) is a MRI signal acquired at echo time t; Tis the echo time of a spin echo, S0I is an initial signal produced by a 90° pulse, S0II is a superposition of initial signals produced by a 90° pulse and a 180° pulse; R2=1/T2, R2*=1/T2*; the parameter δ is in the range of 1.00-1.82....

Claims

What is claimed is:
1. A stormwater runoff treatment substrate, comprising a pyrite substrate layer and a biochar substrate layer; wherein:
the pyrite substrate layer comprises pyrite, oyster shell powder, and sand in a volume ratio of 10:5:85;
the biochar substrate layer comprises biochar or activated carbon, organic nutrient soil, and sand in a volume ratio of 20:3:77.
2. The stormwater runoff treatment substrate of claim 1, wherein a permeability coefficient of the biochar substrate layer is not lower than 200 mm/h; a permeability coefficient of the pyrite substrate layer is not lower than 300 mm/h, and the permeability coefficient of each of the biochar substrate layer and the pyrite substrate layer is not higher than 600 mm/h.
3. The stormwater runoff treatment substrate of claim 2, wherein the biochar substrate layer comprises a mixture of 20 vol. % of biochar, 3 vol. % of organic nutrient soil, 3 vol. % of 5-10 mesh quartz sand, 7 vol. % of 10-20 mesh quartz sand, 40 vol. % of 20-35 mesh quartz sand, 17 vol. % of 30-60 mesh quartz sand, and 10 vol. % of 60-120 mesh quartz sand.
4. The stormwater runoff treatment substrate of claim 2, wherein the pyrite substrate layer comprises a mixture of 10 vol. % of pyrite with a particle size of 1-3 mm, 5 vol. % of oyster shell with a sheet length of 1-3 mm, 3 vol. % of 5-10 mesh quartz, 2 vol. % of 10-20 mesh quartz sand, 35 vol. % of 20-30 mesh quartz sand, 25 vol. % of 30-60 mesh quartz sand, and 20 vol. % of 60-120 mesh quartz sand....

Claims

What is claimed is:
1. A method, comprising:
assembling a motherboard chip, the motherboard chip comprising a motherboard chip body, a first metal region, a first vertical support assembly, and a first waveguide region being arranged on the motherboard chip body, and the first waveguide region comprising a first conventional waveguide region and a first coupling waveguide region used for vertical coupling which are fixedly connected to each other;
assembling a daughterboard chip, the daughterboard chip comprising a daughterboard chip body, a second metal region, a second vertical support assembly and a second waveguide region being arranged on the daughterboard chip body, and the second waveguide region comprising a second conventional waveguide region and a second coupling waveguide region used for vertical coupling which are fixedly connected to each other; and
assembling an integrated chip: fitting the daughterboard chip upside down to a top end of the motherboard chip, fitting the first vertical support assembly to the second vertical support assembly, fitting or approaching the first coupling waveguide region to the second coupling waveguide region to form a vertical waveguide coupler, and fixedly connecting the first metal region to the second metal region.
2. The method of claim 1, wherein during assembling the integrated chip, the first coupling waveguide region is fitted or approached to the second coupling waveguide region to form the vertical waveguide coupler; light enters the first coupling waveguide region from the first conventional waveguide region, then transits from the first coupling waveguide region to the second coupling waveguide region through the vertical waveguide coupler, and enters the second conventional waveguide region from the second coupling waveguide region; or, light enters the second coupling waveguide region from the second conventional waveguide region, then transits from the second coupling waveguide region to the first coupling waveguide region through the vertical waveguide coupler, and enters the first conventional waveguide region from the first coupling waveguide region.
3. The method of claim 2, wherein during assembling the integrated chip, a principle of optical coupling after the first coupling waveguide region is fitted or approached to the second coupling waveguide region comprises directional coupling, evanescent coupling or adiabatic coupling.
4. The method of claim 1, wherein during assembling the integrated chip, the second conventional waveguide region and the first conventional waveguide region are arranged on two sides of the vertical waveguide coupler, respectively.
5. The method of claim 1, wherein during assembling the integrated chip, a manner of fixedly connecting the first metal region to the second metal region comprises eutectic welding or metal bonding.
6. The method of claim 5, wherein during assembling the integrated chip, a manner of forming the first metal region and the second metal region comprises metal evaporation, sputtering or electroplating.
7. The method of claim 5, wherein during assembling the integrated chip, the fixed connection between the first metal region and the second metal region neither hinders the fitting of the second vertical support assembly with the first vertical support assembly nor hinders the fitting or approach of the first coupling waveguide region to the second coupling waveguide region....

Claims

What is claimed is:
1. An isolation member for an atomizer, the isolation member comprising a main body and a pull rod connected to the main body to drag the main body to move, and the main body comprising a hollow channel;
wherein:
the isolation member further comprises a slitting groove at a junction between the main body and the pull rod, and the slitting groove is adapted to facilitate detachment of the pull rod from the main body;
the main body comprises a first sleeve and a second sleeve; a diameter of the first sleeve is smaller than a diameter of the second sleeve; a step is disposed on the second sleeve; and
the first sleeve comprises an outer wall and at least one lubricating boss protruding radially from the outer wall.
2. The isolation member of claim 1, wherein the second sleeve further comprises a flange protruding radially from the step.
3. The isolation member of claim 1, wherein the isolation member comprises an outer surface and a flange protruding radially from the outer surface.
4. The isolation member of claim 2, wherein the pull rod comprises a rod body and a cap portion disposed on one end of the rod body; the cap portion is disposed into an open top of the first sleeve to seal the first sleeve.
5. The isolation member of claim 1, wherein the at least one lubricating boss is in the shape of a sheet and is disposed axially on the outer wall of the first sleeve; or the at least one lubricating boss is disposed helically on the outer wall of the first sleeve; or the at least one lubricating boss is disposed across the outer wall of the first sleeve.
6. The isolation member of claim 1, wherein the first sleeve further comprises a seal boss disposed under the at least one lubricating boss; the seal boss protrudes radially from the outer wall of the first sleeve and is configured to seal an air channel; and an uppermost lubricating boss of the at least one lubricating boss is inclined downward and presents in a shape of a canopy.
7. The isolation member of claim 4, wherein the pull rod further comprises a seal boss protruding radially from the rod body; and the seal boss is inclined downward and presents in a shape of a canopy.
8. The isolation member of claim 1, wherein the main body and the pull rod separately comprise silica gel, latex, rubber, or plastic.
9. An atomizer, comprising an atomizing tube comprising at least one e-liquid inlet, and the isolation member of claim 1, wherein the isolation member is disposed around the atomizing tube to seal the at least one e-liquid inlet; the pull rod comprises a distal end away from the main body and the distal end extends out of the main body....

Claims

What is claimed is:
1. An atomizer, comprising a member for e-liquid injection and vapor discharge, wherein:
the member for e-liquid injection and vapor discharge comprises an outer tube, an inner tube disposed in the outer tube, a seal gasket, and a ceramic heating core;
the inner tube comprises a top end; the top end comprises a disk edge; the top end is integrated with an inner wall of the outer glass tube; the disk edge comprises an e-liquid injection hole; and the e-liquid injection hole communicates with a space between the outer tube and the inner tube;
wherein the outer tube and the inner tube comprise glass, toughened glass, high temperature resistant poly-cyclohexylenedimethylene terephthalate glycol (PCTG), high temperature resistant resin, high temperature resistant acrylic, an explosion-proof film, or a combination thereof;
the space between the outer tube and the inner tube is adapted for storing an e-liquid;
the seal gasket and the ceramic heating core each comprises a central through hole, and the seal gasket is disposed in the central through hole of the ceramic heating core;
a bottom opening of the inner tube is disposed in the central through hole of the ceramic heating core; and a bottom end of the inner tube abuts against the seal gasket or the seat gasket is disposed around the bottom end of the inner tube; whereby the inner tube is supported by the ceramic heating core;
the ceramic heating core is in the shape of a disc; and the ceramic heating core comprises a top flat circular surface, a bottom flat circular surface opposite to the top flat circular surface, a conical edge, and a heating wire; wherein:
the conical edge extends from the top flat circular surface in a direction away from the bottom flat circular surface; and
the conical edge comprises a conical surface gradually reduced in diameter in the direction away from the bottom flat circular surface; the central through hole of the ceramic heating core extends through the conical edge, the top flat circular surface, and the bottom flat circular surface; and
the heating wire is disposed on the bottom flat circular surface;
the conical edge of the ceramic heating core is disposed adjacent to the space between the outer tube and the inner tube; and
the surfaces on the conical edge of the ceramic heating core are adapted for conveying the e-liquid from the space between the outer tube and the inner tube to the bottom flat circular surface to be atomized.
2. The atomizer of claim 1, wherein the member for e-liquid injection and vapor discharge further comprises a fixed ring and a base; the fixed ring is disposed around the base; and a bottom end of the outer tube is disposed around the fixed ring.
3. The atomizer of claim 2, wherein the base comprises an air hole.
4. The atomizer of claim 3, wherein the member for e-liquid injection and vapor discharge further comprises a silicone fixing part; the ceramic heating core is disposed on the silicone fixing part; and the silicone fixing part is disposed in the base.
5. The atomizer of claim 4, wherein the silicone fixing part comprises a central air tube.
6. The atomizer of claim 5, wherein the member for e-liquid injection and vapor discharge further comprises a seal plug; the seal plug comprises a bottom end comprising a sealing protrusion; the seal plug is disposed on a top of the inner tube and the sealing protrusion is configured to seal the e-liquid injection hole of the inner tube after the space between the inner tube and the outer tube is filled with e-liquid.
7. The atomizer of claim 6, wherein the member for e-liquid injection and vapor discharge further comprises a joint and an insulation ring; the insulation ring is disposed in a bottom of the base to separate a positive lead from a negative lead of the ceramic heating core and meanwhile fix the negative lead; and the joint is disposed in the insulation ring to fix the positive lead of the ceramic heating core.
8. The atomizer of claim 7, wherein the member for e-liquid injection and vapor discharge further comprises a mouthpiece and a seal ring; the seal ring is disposed around the mouthpiece to seal a gap between the mouthpiece and the outer tube thus preventing the leakage of air and vapor; and the mouthpiece is disposed on a top of the outer tube and is disposed around the seal plug....

Claims

The invention claimed is:
1. A method, comprising:
1) defining a maximum speed spd_max_ref and a minimum speed spd_min_ref of an electronically commutated motor (ECM) within a constant-torque operation range;
2) by using a proportional integral (PI) controller, calculating an upper reference torque T_ref_up with the maximum speed spd_max_ref as a first reference speed, and calculating a lower reference torque T_ref_low with the minimum speed spd_min_ref as a second reference speed; and T_ref_up>T_ref_low;
3) receiving an externally input torque command Tcom;
4) comparing the torque command Tcom, the upper reference torque T_ref_up, and the lower reference torque T_ref_low to determine a target torque Tact; and
5) controlling the ECM to operate in a constant torque mode under the target torque Tact.
2. The method of claim 1, wherein in 4), if Tcom is greater than T_ref_up, let Tact=T_ref_up; if Tcom is less than T_ref_low, let Tact=T_ref_low; if Tcom falls between T_ref_up and T_ref_low, let Tact=Tcom.
3. The method of claim 2, wherein in 2), by using the PI controller, an upper integral value interger_up is also acquired with the maximum speed spd_max_ref as the first reference speed, and a lower integral value interger_low with the minimum speed spd_min_ref as the second reference speed; in 4), if Tcom is greater than T_ref_up, let Tact=T_ref_up, and interger_up=Tact; if Tcom is less than T_ref_low, let Tact=T_ref_low, and interger_low=Tact; if Tcom falls between T_ref_up and T_ref_low, let Tact=Tcom, and interger_low=Tact, interger_up=Tact.
4. The method of claim 3, wherein between 4) and 5), the method further comprises: calculating a maximum output torque Tmax based on a rotational speed SPD and a maximum output power of the EC motor; and comparing Tact with Tmax; if Tact is greater than Tmax, let Tact=Tmax.
5. The method of claim 4, wherein the maximum output torque Tmax is calculated from the rotational speed SPD and the maximum output power P_out_max.
6. The method of claim 5, wherein a dynamometer is used to ensure the EC motor operates at the maximum output power P_out_max, and the EC motor produces the maximum output torque Tmax through adjusting the rotational speed SPD.
7. The method of claim 2, wherein between 4) and 5), the method further comprises: calculating a maximum output torque Tmax based on a rotational speed SPD and a maximum output power of the EC motor; and comparing Tact with Tmax; if Tact is greater than Tmax, let Tact=Tmax.
8. The method of claim 7, wherein the maximum output torque Tmax is calculated from the rotational speed SPD and the maximum output power P_out_max.
9. The method of claim 8, wherein a dynamometer is used to ensure the EC motor operates at the maximum output power P_out_max, and the EC motor produces the maximum output torque Tmax through adjusting the rotational speed SPD.
10. The method of claim 1, wherein between 4) and 5), the method further comprises: calculating a maximum output torque Tmax based on a rotational speed SPD and a maximum output power of the EC motor; and comparing Tact with Tmax; if Tact is greater than Tmax, let Tact=Tmax.
11. The method of claim 10, wherein the maximum output torque Tmax is calculated from the rotational speed SPD and the maximum output power P_out_max.
12. The method of claim 11, wherein a dynamometer is used to ensure the EC motor operates at the maximum output power P_out_max, and the EC motor produces the maximum output torque Tmax through adjusting the rotational speed SPD....

Claims

What is claimed is:
1. A method, comprising:
(1) performing dynamic PET scanning on biological tissues injected with a standard-dose tracer I to obtain a PET Standard-dose Single-tracer Sinogram (SSS1) corresponding to the tracer I; and performing dynamic PET scanning on biological tissues injected only with a standard-dose tracer II to obtain a PET Standard-dose Single-tracer Sinogram (SSS2) corresponding to the tracer II at an interval of 5 half-lives of the tracer I, wherein the standard-dose generally refers to a dose that is able to reconstruct an activity map using a traditional reconstruction algorithm;
(2) calculating, by a PET reconstruction algorithm, PET Standard-dose Single-tracer Activity Maps 1 and 2 (SSA1 and SSA2) corresponding to the SSS1 and the SSS2, respectively;
(3) normalizing and superimposing the SSS1 and the SSS2 to form a PET Standard-dose Dual-tracer Sinogram (SDS); down-sampling the SSS1 and the SSS2 respectively to obtain PET Low-dose Single-tracer Sinograms 1 and 2 (LSS1 and LSS2), and superimposing the LSS1 and the LSS2 to form a PET Low-dose Dual-tracer Sinogram (LDS); and normalizing and superimposing the SSA1 and the SSA2 to form a PET Standard-dose Dual-tracer Activity Map (SDA);
(4) repeating (1) to (3) several times to obtain a plurality of samples, and dividing these samples into a train set, a validation set and a test set, where each set of samples comprises the SSS1, the SSS2, the SDS, the LDS, the SSA1, the SSA2 and the SDA;
(5) building an attention mechanism-based network model comprising a sinogram part and a reconstruction part, inputting the LDS in the samples of the train set into the sinogram part, and serving the SSS1 and the SSS2 in the corresponding set of samples as labels of the sinogram part, so as to pre-train the sinogram part;
(6) cascading the pre-trained sinogram part with the reconstruction part, inputting the LDS in the samples of the train set into the sinogram part, serving the SSS1 and the SSS2 in the corresponding set of samples as the labels of the sinogram part and the SSA1 and the SSA2 as labels of the reconstruction part, so as to train the entire network model; and
(7) inputting the LDS in the samples of the test set into the trained network model to achieve low-dose dual-tracer PET image reconstruction and obtain corresponding reconstructed SSS1, SSS2, SSA1 and SSA2.
2. The method of claim 1, wherein the half-lives of the two tracers I and II used in (1) are arbitrary, and the method is applicable even if the two tracers are labeled with identical radionuclides, and is robust to tracer combinations, individual differences and sampling protocols.
3. The method of claim 1, wherein the sinogram part is used to convert the LDS to the SSS, to estimate a standard dose and separate dual-tracer signals simultaneously; and Filtered Back Projection-Net (FBP-Net) is adopted in the reconstruction part.
4. The method of claim 1, wherein the network model operates as follows:
a) allowing the input LDS to pass through two convolution blocks in sequence to extract shallow features and enter a spatial attention module, where the spatial attention module makes statistics on a spatial distribution of an input feature map by two convolution layers to obtain an initial weight map of the same size as the feature map, normalizing the weight map by a Sigmoid layer, and multiplying the feature map input by the normalized weight map to obtain a new feature map;
b) extracting, by two convolution kernels, bin and angle information simultaneously of the feature map output by the spatial attention module, combining extracted feature information in a channel, and fusing the information by passing through two convolution layers in sequence and inputting the information to a channel attention module;
c) aggregating, by the channel attention module, spatial features of all channels of the input feature map by an average pooling layer and a max pooling layer respectively to obtain two spatial descriptors to represent the spatial feature distribution of different channels; combining the two spatial descriptors by a first fully connected layer and passing through an ReLU layer and a second fully connected layer in sequence to generate a weight for each channel; and
normalizing the weight for each channel by the Sigmoid layer to generate a channel weight map; and
d) multiplying the feature map input by the channel attention module by the normalized channel weight map to obtain a new feature map which is adjusted by one convolution layer, and respectively normalizing the two PET SSSS in the adjusted feature map as outputs of the sinogram part.
5. The method of claim 1, wherein when the sinogram part is pre-trained in (5), the LDSs at different time frames is put in a channel of an input layer, so that multi-frame information is fused together only in a single convolution, and temporal and spatial information of the sinogram is used simultaneously in a subsequent convolution; and the spatial attention module is concerned with the spatial information of the sinogram, while the channel attention module is concerned with the temporal information of the sinogram.
6. The method of claim 1, wherein the sinogram part is pre-trained in (5) as follows: initializing network parameters of the sinogram part, the network parameters comprising a bias vector and weight matrix of each layer, a learning rate, an optimization algorithm and max iterations; inputting the LDSs in the train set into the sinogram part in batches and optimizing the network parameters using a loss function L, and continuously updating the network parameters of the sinogram part by Batch Gradient Descent until the loss function L converges or reaches the max iterations.
7. The method of claim 1, wherein the entire network model is trained in (6) as follows: initializing network parameters of the entire network model, the network parameters comprising a bias vector and weight matrix of each layer, a learning rate, an optimization algorithm and max iterations; inputting the LDSs in the train set into the sinogram part of the network in batches and optimizing the network parameters using the loss function L, and continuously updating the network parameters of the entire network model by Batch Gradient Descent until the loss function L converges or reaches the max iterations.
8. The method of claim 6, wherein the loss function L is expressed as follows:
L
=
arg
⁢
min
ω
,
b
[
α
·
M
⁢
S
⁢
E
⁡
(
x
,
y
)
-
β
·
ln
⁢
1
+
S
⁢
S
⁢
I
⁢
M
⁡
(
x
,
y
)
2
+
η
·
M
⁢
S
⁢
E
⁡
(
T
⁢
V
⁡
(
x
)
,
T
⁢
V
⁡
(
y
)
)
]
;
where x and y are outputs and labels of the sinogram part or the entire network model, respectively; TV( ) is a total variation operator, MSE( ) is a mean square error operator, SSIM( ) is a structural similarity operator, α, β and η are a weight factor of corresponding bound terms, respectively; ω and b are a weight matrix and the bias vector of the sinogram part or the entire network model, respectively.
9. The method of claim 7, wherein the loss function L is expressed as follows:
L
=
arg
⁢
min
ω
,
b
[
α
·
M
⁢
S
⁢
E
⁡
(
x
,
y
)
-
β
·
ln
⁢
1
+
S
⁢
S
⁢
I
⁢
M
⁡
(
x
,
y
)
2
+
η
·
M
⁢
S
⁢
E
⁡
(
T
⁢
V
⁡
(
x
)
,
T
⁢
V
⁡
(
y
)
)
]
;
where x and y are outputs and labels of the sinogram part or the entire network model, respectively; TV( ) is a total variation operator, MSE( ) is a mean square error operator, SSIM( ) is a structural similarity operator, α, β and η are a weight factor of corresponding bound terms, respectively; ω and b are a weight matrix and the bias vector of the sinogram part or the entire network model, respectively.
10. The method of claim 1, wherein after the entire network model is trained in (6), the network model is further validated and parameters thereof are fine-tuned by samples in the validation set....

Claims

What is claimed is:
1. A method for in-situ measuring settleability of activated sludge using a device, the device comprising:
1) a sample chamber comprising a stagnant zone;
2) an ultrasonic time domain reflectometer;
3) a magnetic stirrer;
4) an ultrasonic probe;
5) a sample inlet; and
6) a sample outlet;
wherein:
the sample chamber is configured to hold an activated sludge sample, and the ultrasonic time domain reflectometer is configured to measure settling characteristics of the activated sludge sample;
the sample inlet and the sample outlet communicate with the sample chamber; the stagnant zone comprises a top part, a sidewall, and a bottom part;
the sample inlet is connected to the top part of the stagnant zone; the sample outlet is connected to the sidewall of the stagnant zone; the magnetic stirrer is disposed at the bottom part of the stagnant zone; and
the ultrasonic probe is disposed on the top part of the stagnant zone; and the ultrasonic time domain reflectometer is connected to the ultrasonic probe to transmit signals;
the method comprising:
1) collecting an activated sludge sample in a target location using a constant flow peristaltic pump;
2) guiding the activated sludge sample from the sample inlet into the stagnant zone; starting the magnetic stirrer to mix the activated sludge sample where exhaust gas is produced; and removing the exhaust gas out of the stagnant zone through an exhaust pipe communicating with the stagnant zone;
3) stopping the magnetic stirrer; turning on the ultrasonic time domain reflectometer to control the ultrasonic probe to emit an ultrasonic signal to monitor the activated sludge sample in the stagnant zone for 30 minutes; collecting the ultrasonic signal by an oscilloscope of the ultrasonic time domain reflectometer, and showing an ultrasonic waveform change diagram over time;
4) forming a sludge settling displacement curve according to the ultrasonic waveform change diagram;
5) obtaining a displacement value at 30th minute according to the sludge settling displacement curve; and calculating a sludge volume index (SVI) according to a fitted equation; and
6) removing the activated sludge sample out of the stagnant zone through a peristaltic pump.
2. The method of claim 1, wherein in 4), the sludge settling displacement curve is formed as follows: obtaining a maximum displacement value at a target peak of the ultrasonic waveform change diagram during each time period; taking a displacement value at 0 minute as a benchmark, calculating a difference between the maximum displacement value during each time period and the benchmark, and drawing the sludge settling displacement curve with time as abscissa and the difference as ordinate.
3. The method of claim 1, wherein in 5), the fitted equation is formed by linear regression of SVI value and displacement value that are respectively derived from a weight subtraction method and an ultrasonic time domain detection; and the fitted equation is expressed as y=4.3x+254.3; where y is the sludge volume index, and x is the displacement at 30th minute.
4. The method of claim 1, wherein the ultrasonic transmitter is operated at a pulse repetition frequency of 10-20 Hz, a pulse resistance is 10-50Ω, a pulse voltage is 100-400 V, a gain is 50-60 dB, a high-pass filter is 0.03-0.1 MHz, and a low-pass filter is 1-3 MHz.
5. The method of claim 1, wherein in 3), the oscilloscope collects the ultrasonic signal once every 2-60 seconds....

Claims

What is claimed is:
1. An inorganic adhesive, comprising: magnesium oxide, magnesium sulfate heptahydrate, silica sol, lithium silicate, sodium silicate, citric acid, microcrystalline cellulose, cellulose nanowhiskers, amino trimethylene phosphonic acid, and water.
2. The inorganic adhesive of claim 1, wherein the inorganic adhesive further comprises redispersible latex powder and silica fume.
3. The inorganic adhesive of claim 2, wherein a mass ratio of magnesium oxide to magnesium sulfate heptahydrate to silica fume to silica sol to lithium silicate to sodium silicate to citric acid to microcrystalline cellulose to cellulose nanowhiskers to redispersible latex powder to amino trimethylene phosphonic acid to water is 1:0.2-0.6:0.01-0.1:0.001-0.03:0.00002-0.02:0.002-0.03:0.002-0.03:0.002-0.03:0.0005-0.01:0-0.002:0.001-0.01:0.2-0.8.
4. The inorganic adhesive of claim 3, wherein a mass ratio of magnesium oxide to magnesium sulfate heptahydrate to silica fume to silica sol to lithium silicate to sodium silicate to citric acid to microcrystalline cellulose to cellulose nanowhiskers to redispersible latex powder to amino trimethylene phosphonic acid to water is 1:0.3-0.5:0.02-0.08:0.002-0.02:0.005-0.01:0.005-0.02:0.005-0.02:0.005-0.01:0.001-0.005:0.0001-0.001:0.002-0.006:0.3-0.6.
5. The inorganic adhesive of claim 1, wherein magnesium oxide is light-burned magnesia, with an activity of 58 or above; magnesium sulfate heptahydrate is in an industrial grade, with an effect content of ≥90%; and silica fume has a SiO2 content >90%, and a particle size of 50-260 nm.
6. The inorganic adhesive of claim 1, wherein the silica sol is a liquid, with a particle size of 7-25 nm; lithium silicate is a solid or a liquid, with a modulus of 1.5-3.5, and the solid is dissolved in water before use; sodium silicate is a solid or a liquid, with a modulus of 1.5-3.0, and the solid is dissolved in water before use.
7. The inorganic adhesive of claim 1, wherein citric acid is powder, with a purity of >95%.
8. The inorganic adhesive of claim 1, wherein the microcrystalline cellulose is prepared from plant fibers, with a particle size of 20-80 μm; the cellulose nanowhiskers are prepared from microcrystalline fibers, with a diameter of 5-20 nm and a length of 100-600 nm; liquid or solid; the solid is ultrasonically dispersed in water for 15-20 min before use.
9. The inorganic adhesive of claim 1, wherein the redispersible latex powder has a purity of >95% and a bulk density ≥450 g/L; and the redispersible latex powder is selected from the group consisting of ethylene-vinyl acetate copolymer, vinyl acetate-vinyl tertiary carbonate copolymer, acrylic acid copolymer, and a combination thereof.
10. The inorganic adhesive of claim 9, wherein the redispersible latex powder is ethylene-vinyl acetate copolymer.
11. The inorganic adhesive of claim 1, wherein amino trimethylene phosphonic acid is powder or liquid, with a chloride ion content <1%....

Claims

The invention claimed is:
1. A method of improving grinding, grading and capacity of ores, the method comprising:
providing a two-stage ore grinding and grading system comprising a first fully closed circuit comprising a grinder and a hydrocyclone, wherein:
the hydrocyclone comprises a feeding pipe, a cylinder, a cone body, a release nozzle, and an overflow pipe; the cone body comprises a grading section and a separation section;
the feeding pipe is connected to the cylinder;
the feeding pipe is adapted to introduce feeding ores into the cylinder for rotation;
the grading section of the cone body is connected to the cylinder, and the separation section of the cone body is connected to the release nozzle;
the overflow pipe is disposed within the cylinder;
the hydrocyclone is adapted to rotate the feeding ores to create an overflow and underflow ores;
the release nozzle is adapted to discharge the underflow ores out of the hydrocyclone to the grinder; and
the overflow pipe is adapted to discharge the overflow out of the hydrocyclone; and
controlling parameters for ore grinding and grading as follows: controlling a centrifugal force strength dcan value of a point B; in the separation section;
controlling a fineness content ratio θ0 in the underflow ores; controlling a second-stage ore grinding and grading load Q2; and acquiring a first-stage grinding, grading and capacity Q of ores.
2. The method of claim 1, wherein in the grading section, a centrifugal force strength dnan at a point A is 12-13 gravitational accelerations; in the separation section, a centrifugal force strength dcan at a at the point B is 72.6-84.45 gravitational accelerations; and the centrifugal force strength dcan at the point B of the separation section is 6.05-6.50 times of an an at the point A of the grading section.
3. The method of claim 1, wherein the fineness content ratio θ0 in the underflow ores in the hydrocyclone is 23.74-16.52%.
4. The method of claim 2, wherein the fineness content ratio θ0 in the underflow ores in the hydrocyclone is 23.74-16.52%.
5. The method of claim 1, wherein reducing the fineness content ratio θ0 in the underflow ores in the hydrocyclone decreases tons of −200 mesh grade ores in the underflow ores, and one ton of new capacity is increased, with a convertible ratio as follows:
1) A convertible ratio of medium-low grade collophanite is 1.512:1, which means, every 1.512 tons of −200 mesh grade ores in the underflow ores of the medium-low grade collophanite is reduced, and one ton of new capacity of the medium-low grade collophanite is increased;
2) A convertible ratio of copper oxide ores is 2.64:1, which means, every 2.64 tons of −200 mesh grade ores in the underflow ores of the copper oxide ores is reduced, and one ton of new capacity of the copper oxide ores is increased; and
3) A convertible ratio of bauxite is 2.45:1, which means, every 2.45 tons of −200 mesh grade ores in the underflow ores of the bauxite is reduced, and one ton of new capacity of the bauxite is increased.
6. The method of claim 1, wherein the centrifugal force strength dcan at the point B of the separation section of the hydrocyclone is calculated as follows: the centrifugal force strength dcan at the point B=5875.69 KD2×Ka2×P×dn2/dc3;
KD is a diameter correction coefficient of the hydrocyclone;
Ka is a core angle correction coefficient of the hydrocyclone;
dn is an equivalent diameter of the feeding pipe, cm;
dc is a diameter of the overflow pipe, cm;
P is an ore feeding pressure, MPa; and
5875.69 is a constant value.
7. The method of claim 1, wherein a concentration and a fineness of the overflow in the hydrocyclone are increased respectively, as follows:
1) 3.01% and 2.3% for medium-low grade collophanite;
2) 1% and 3.5% for copper oxide ores; and
3) 0.61% and 6.71% for bauxite.
8. The method of claim 1, wherein a cylindrical diameter D of the hydrocyclone is Φ466-Φ500 mm....

Claims

What is claimed is:
1. A chest binder, comprising:
a front part; and
a back part;
wherein:
the front part comprises a front piece comprising at least one layer of elastic fabric, and a percent elongation of the elastic fabric is between 1% and 5%;
the back part comprises an X-shaped back piece and a tightenable piece connected to a lower end of the back piece; the back piece comprises an inner layer and a surface layer; the surface layer is attached to the inner layer to form an integrated structure; the inner layer comprises a left back strap and a right back strap;
the tightenable piece is connected to the left back strap and the right back strap, and two sides of the tightenable piece are connected to two sides of the front piece, respectively; and
the front piece comprises a left front strap and a right front strap which are respectively connected to the left back strap and the right back strap.
2. The binder of claim 1, wherein the front piece comprises an inner fabric and an outer fabric attached to the inner fabric to form an integrated structure; and a percent elongation of the inner fabric is less than that of the outer fabric.
3. The binder of claim 2, wherein the inner fabric is a composite layer comprising at least two layers of elastic fabric which are attached to each other to form an integrated structure, and a percent elongation of the composite layer is less than that of the outer fabric.
4. The binder of claim 3, wherein connecting lines of the left front strap and the left back strap, and of the right front strap and the right back strap, are disposed on the back part and are configured to correspond to trapeziuses of a wearer.
5. The binder of claim 4, wherein an outer edge line of the left front strap is configured to extend from a rear side of a trapezius of a left shoulder of the wearer through an outside of a left accessory breast of the wearer to a rear position of a left armpit of the wearer; and an outer edge line of the right front strap is configured to extend from a rear side of a trapezius of a right shoulder of the wearer through an outside of a right accessory breast of the wearer to a rear position of a right armpit of the wearer.
6. The binder of claim 5, wherein an outer edge line of the left back strap is configured to extend from the rear side of the trapezius of the left shoulder of the wearer along a left shoulder blade of the wearer to a vicinity of an eighth rib behind the left armpit of the wearer; and an outer edge line of the right back strap is configured to extend from the rear side of the trapezius of the right shoulder of the wearer along a right shoulder blade of the wearer to a vicinity of an eighth rib behind the right armpit of the wearer.
7. The binder of claim 6, wherein a lower end of the outer edge line of the left back strap and a lower end of the outer edge line of the right back strap are configured to be in the vicinity of the eighth rib behind the left armpit of the wearer and the eighth rib behind the right armpit of the wearer, respectively.
8. The binder of claim 7, wherein the tightenable piece comprises a top edge configured to extend to a fifth thoracic vertebra of the wearer, a bottom edge configured to extend to an eleventh thoracic vertebra of the wearer, and two sides configured to respectively extend to the left armpit and the right armpit of the wearer.
9. The binder of claim 8, wherein a percent elongation of the inner layer of the back piece is greater than that of the front piece.
10. The binder of claim 8, wherein one layer of the composite layer intended to contact skin of the wearer is a single sided moisture conducting fabric....

Claims

The invention claimed is:
1. An atomizer, comprising an e-liquid tank and a seal member; wherein
the e-liquid tank comprises a cavity; the seal member is disposed on one end of the e-liquid tank; the seal member comprises a groove configured to equalize a pressure in the e-liquid tank with outside pressure;
the e-liquid tank comprises a distal end, a mouthpiece, and an air conduction tube; the distal end is away from the seal member and the mouthpiece is disposed on the distal end; the air conduction tube extends from the mouthpiece into the e-liquid tank; the air conduction tube is connected to the seal member; and the groove is disposed at a wall junction between the seal member and the air conduction tube; and
the seal member comprises a first main body and a second main body; the second main body is hollow and has a reduced diameter than the first main body; the air conduction tube is disposed through the second main body into the first main body, so that an inner wall of the second main body abuts against an outer wall of the air conduction wall; the groove is disposed on the inner wall of the second main body.
2. The atomizer of claim 1, wherein the second main body comprises a sidewall and at least one e-liquid inlet disposed on the sidewall; an e-liquid absorbent member comprises a heating element and is disposed in the second main body; at least one end of the e-liquid absorbent member abuts against an edge of the at least one e-liquid inlet; the air conduction tube abuts against the e-liquid absorbent member; and/or the air conduction tube comprises a proximal end abutting against the seal member; the air conduction tube further comprises a notch disposed on the proximal end and communicating with the groove.
3. The atomizer of claim 2, wherein one end of the groove extends through an upper opening of the second main body into the cavity; the other end of the groove extends at least to the wall junction between the seal member and the air conduction tube.
4. The atomizer of claim 1, wherein the groove has a depth of 0.01-0.5 mm and a width of ≤3 mm.
5. The atomizer of claim 1, wherein the second main body further comprises two e-liquid inlets disposed on the sidewall and opposite to one another; the second main body further comprises two slots disposed on the sidewall and opposite to one another; the two slots are disposed under the two e-liquid inlets, respectively; both ends of the e-liquid absorbent member are disposed in the two slots and abuts against the inner wall of the second main body to block the two e-liquid inlets.
6. The atomizer of claim 2, wherein the seal member comprises rubber; and/or the e-liquid absorbent member comprises a porous material; and/or the e-liquid absorbent member comprises an e-liquid absorbent cotton, or a piece of cotton wrapped about a ceramic body member.
7. The atomizer of claim 5, wherein the atomizer further comprises a fixing member and the e-liquid tank comprises a bottom portion away from the mouthpiece; the fixing member cooperates with the bottom portion of the e-liquid tank to form an air conduction space; the fixing member comprises a peripheral wall, a recess portion, at least one first air inlet, and at least one second air inlet; the at least one first air inlet and the at least one second air inlet are disposed on the peripheral wall, and communicate with the air conduction space; and the at least one first air inlet communicates with the recess portion.
8. The atomizer of claim 7, wherein the fixing member further comprises a base portion and a third air inlet disposed on the base portion; the atomizer further comprises a first electrode and a second electrode both disposed on the base portion and electrically connected to the heating element; both ends of the third air inlet communicate with the second air inlet and atmosphere, respectively.
9. The atomizer of claim 8, wherein the e-liquid absorbent member is disposed horizontally in the second main body; the heating element is wound around a middle portion of the e-liquid absorbent member; and the heating element and the middle portion of the e-liquid absorbent member are exposed in the air conduction tube.
10. An electronic cigarette, comprising the atomizer of claim 1 and a battery assembly....

Claims

What is claimed is:
1. A tire inflator, comprising:
1) an air pump; the air pump comprising an air outlet end;
2) an inner housing, the inner housing comprising a chamber and the air pump being disposed in the chamber; the air outlet end being embedded in the inner housing and extending out of the chamber;
3) A lighting assembly, the lighting assembly being disposed in the chamber and adjacent to the air outlet end; and
4) An outer housing for heat dissipation, the outer housing surrounding the inner housing and comprising a through hole; the air outlet end being disposed through the through hole, and at least a part of the lighting assembly abutting against the outer housing;
wherein the lighting assembly comprises:
a lighting element disposed in the chamber and being attached to an inner wall of the inner housing;
a heat dissipation element connected to the lighting element; and
a thermal conduction element comprising a first end connected to the heat dissipation element and a second end connected to the outer housing.
2. The tire inflator of claim 1, wherein the air outlet end is surrounded by a silicone grease, and the silicone grease is further attached to edges of two ends of the through hole.
3. The tire inflator of claim 1, wherein the inner housing further comprises an opening, and the lighting element is disposed towards the opening.
4. The tire inflator of claim 1, wherein the heat dissipation element comprises:
a base connected to the lighting element; and
a plurality of radiating ribs connected to the base, and the plurality of radiating ribs being spaced apart and perpendicular to the base.
5. The tire inflator of claim 4, wherein the plurality of radiating ribs comprises:
a front rib group connected to the base, and the front rib group being next to the inner wall of the inner housing; and
a tail rib group connected to the base, the tail rib group being side by side with the front rib group, and being away from the inner wall of the inner housing; and
the front rib group is uneven with the tail rib group, so that a space is formed by the front rib group and the tail rib group.
6. The tire inflator of claim 4, wherein the thermal conduction element comprises:
a first conductive end connected to one of the plurality of radiating ribs, and being disposed between two adjacent radiating ribs of the plurality of radiating ribs;
a second conductive end connected to the outer housing through a hole disposed on the inner housing; and
a connection part connecting the first conductive end and the second conductive end; and
both the first conductive end and the second conductive end are perpendicular with respect to the connection part, and the first conductive end is not in a line with the second conductive end.
7. The tire inflator of claim 6, wherein the inner housing comprises a first side wall comprising at least one first ventilation hole; the outer housing comprises a second side wall comprising at least one second ventilation hole; and the at least one first ventilation hole is matched with the at least one second ventilation hole.
8. The tire inflator of claim 7, wherein the at least one first ventilation hole comprises a plurality of front ventilation holes and a plurality of tail ventilation holes; the plurality of front ventilation holes is closer to the lighting element than the plurality of tail ventilation holes; the plurality of tail ventilation holes is away from the lighting element; and the plurality of front ventilation holes and the plurality of tail ventilation holes form an air passage for heat dissipation.
9. The tire inflator of claim 7, further comprising a plurality of grilles disposed between the inner housing and the outer housing in positions corresponding to the at least one first ventilation hole and the at least one second ventilation hole....

Claims

What is claimed is:
1. An air blower, comprising:
a volute, the volute comprising an end plate, a side plate extending from an edge of the end plate, and a cavity formed by the end plate and the side plate;
a centrifugal wind wheel; and
a motor;
wherein:
the centrifugal wind wheel is disposed in the cavity;
the end plate comprises an air inlet, and two ends of the side plate are disposed side by side to form an air outlet;
the end plate further comprises a support beam opposite to the air inlet, and the motor is disposed on the support beam;
a middle part of the support beam is sunken in a direction away from the air inlet of the volute to form a chamber, and the motor is accommodated in the chamber;
the middle part of the support beam comprises a through hole, and a rotating shaft of the motor passes through the through hole to connect to the centrifugal wind wheel;
the middle part of the support beam further comprises at least two first mounting holes disposed at two sides of the through hole; the motor comprises at least two second mounting holes matched with the at least two first mounting holes; and the motor is fixed on the support beam through a bolt-nut mechanism sequentially passing through the at least two first mounting holes and the at least two second mounting holes;
the end plate, the side plate, and the support beam are integrally formed; and
the centrifugal wind wheel comprises a wheel disc and a plurality of vanes circumferentially disposed on the wheel disc; the wheel disc comprises a central part, and a connection plate is disposed in the central part and is connected to the rotating shaft of the motor; an annular guide plate is disposed between the connection plate and the wheel disc; the plurality of vanes each comprises a pressure side comprising a first arc and a second arc; a radius R1 of the first arc is 4.53±0.5 mm; a radius R2 of the second arc is 10.43±0.5 mm; an inner diameter D1 of the plurality of vanes is 111.61±5 mm; an outer diameter D2 of the plurality of vanes is 131.17±5 mm; an included angle β1A between a tangent of a blade inlet profile and a circumferential direction is 83.93±5°, and an included angle β2A between a tangent of a blade outlet profile and a circumferential direction is 143.42±5°.
2. The air blower of claim 1, wherein the volute is a plastic shell formed by injection molding or is a sheet metal shell formed by stamping; the motor comprises a starting capacitor, and the centrifugal wind wheel comprises plastic.
3. The air blower of claim 1, wherein the volute comprises a volute tongue in the vicinity of the air outlet; the volute further comprises an air passage formed between the side plate of the volute and the centrifugal wind wheel; and a cross sectional area of the air passage increases along a direction from the volute tongue to the air outlet.
4. An exhaust fan, comprising a box and an air blower of claim 1; wherein the box comprises a top plate, a side wall, and a bottom plate; the top plate, the side wall, and the bottom plate are connected to each other to form an accommodation cavity; the side wall comprises an air exit, and the top plate comprises an air intake; and the air blower is disposed in the accommodation cavity.
5. The exhaust fan of claim 4, wherein the volute is disposed on the bottom plate of the box; the end plate, the side plate of the volute, and the bottom plate of the box form a sealed cavity, and the centrifugal wind wheel is disposed in the sealed cavity....

Claims

What is claimed is:
1. A method, comprising:
1) dissolving a sulfide in an alkaline solution to form a mixed solution with a pH of 12-13;
2) adding sodium silicate to the mixed solution and stirring for 0.5-1 hour at 20-40° C.;
3) adding an aqueous solution of a ferrous salt to the mixed solution containing sodium silicate, and allowing to react at 40-60° C. for 2-3 hours; where, with decrease of the pH of the mixed solution, sodium silicate is converted into silica nanoparticles, and the ferrous salt reacts with the sulfide to form ferrous sulfide; and
4) further adding an aqueous solution of an organic modifier to the mixed solution, and allowing to react at 40-60° C. for 1-2 hours to form a passivator slurry comprising surface-modified ferrous sulfide doped with silicon dioxide; filtering the passivator slurry through suction filtration to form a filter cake passivator or spray drying the passivator slurry to form a dry powdery passivator.
2. The method of claim 1, wherein in 1), the sulfide is sodium hydrosulfide, sodium sulfide, potassium sulfide, ammonium sulfide, or a mixture thereof.
3. The method of claim 1, wherein a molar ratio of the sulfide to the ferrous salt is between 0.85:1 and 1.00:1; sodium silicate is quantified by silicon dioxide, and a mass ratio of silicon dioxide to ferrous sulfide is between 1:1 and 1:2; and a molar ratio of the organic modifier to the ferrous salt is between 0.05:1 and 0.15:1.
4. The method of claim 2, wherein a molar ratio of the sulfide to the ferrous salt is between 0.85:1 and 1.00:1; sodium silicate is quantified by silicon dioxide, and a mass ratio of silicon dioxide to ferrous sulfide is between 1:1 and 1:2; and a molar ratio of the organic modifier to the ferrous salt is between 0.05:1 and 0.15:1.
5. The method of claim 3, wherein in 3), the ferrous salt is ferrous sulfate, ferrous chloride, or a mixture thereof.
6. The method of claim 4, wherein in 3), the ferrous salt is ferrous sulfate, ferrous chloride, or a mixture thereof.
7. The method of claim 1, wherein in 4), the organic modifier is at least one of sodium humate, potassium humate, and dialkyl dithiocarbamic acid comprising 1 to 10 carbon atoms or a salt thereof.
8. The method of claim 1, wherein in 1), the alkaline solution is a 1-5 mol/L aqueous solution of sodium hydroxide or potassium hydroxide.
9. A passivator for removing a heavy metal from soil prepared according to the method of claim 1, the passivator comprising surface-modified ferrous sulfide doped with silicon dioxide.
10. A method for improvement of heavy-metal-contaminated soil, the method comprising adding the passivator of claim 9 to the soil.
11. The method of claim 10, wherein the passivator accounts for 1-4 wt. % of the soil....